\
| Variant ID: vg0517819523 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 17819523 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, A: 0.00, others allele: 0.00, population size: 259. )
CGTGTTCTTAGGATTAGTGCTTACATCTTCATGACGCTCTAATCTTATTTATATAATTCGTCAAGTTACCATATACCTTATATAATCTTCAGCAATATCG[T/A]
TATCTAATCTACTATCGGCTAATATTTGTATGCAAAAGACAGCCGATTAGGTTAGATCTCGACATTGATCTAGATTATATAAGATATCTACCATTCTATG
CATAGAATGGTAGATATCTTATATAATCTAGATCAATGTCGAGATCTAACCTAATCGGCTGTCTTTTGCATACAAATATTAGCCGATAGTAGATTAGATA[A/T]
CGATATTGCTGAAGATTATATAAGGTATATGGTAACTTGACGAATTATATAAATAAGATTAGAGCGTCATGAAGATGTAAGCACTAATCCTAAGAACACG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.50% | 4.50% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 99.10% | 0.80% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 34.90% | 65.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.50% | 1.40% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0517819523 | T -> A | LOC_Os05g30750.1 | downstream_gene_variant ; 3058.0bp to feature; MODIFIER | silent_mutation | Average:30.576; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| vg0517819523 | T -> A | LOC_Os05g30760.1 | downstream_gene_variant ; 1853.0bp to feature; MODIFIER | silent_mutation | Average:30.576; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| vg0517819523 | T -> A | LOC_Os05g30750.2 | downstream_gene_variant ; 3058.0bp to feature; MODIFIER | silent_mutation | Average:30.576; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| vg0517819523 | T -> A | LOC_Os05g30750.3 | downstream_gene_variant ; 3058.0bp to feature; MODIFIER | silent_mutation | Average:30.576; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| vg0517819523 | T -> A | LOC_Os05g30750.6 | downstream_gene_variant ; 3058.0bp to feature; MODIFIER | silent_mutation | Average:30.576; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| vg0517819523 | T -> A | LOC_Os05g30750.5 | downstream_gene_variant ; 3058.0bp to feature; MODIFIER | silent_mutation | Average:30.576; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| vg0517819523 | T -> A | LOC_Os05g30750.7 | downstream_gene_variant ; 3058.0bp to feature; MODIFIER | silent_mutation | Average:30.576; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| vg0517819523 | T -> A | LOC_Os05g30750.4 | downstream_gene_variant ; 3058.0bp to feature; MODIFIER | silent_mutation | Average:30.576; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| vg0517819523 | T -> A | LOC_Os05g30750-LOC_Os05g30760 | intergenic_region ; MODIFIER | silent_mutation | Average:30.576; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0517819523 | NA | 2.53E-08 | mr1028 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517819523 | NA | 3.10E-06 | mr1126 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517819523 | NA | 2.56E-08 | mr1348 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517819523 | NA | 2.76E-08 | mr1369 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517819523 | NA | 8.30E-06 | mr1373 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517819523 | NA | 3.33E-09 | mr1453 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517819523 | NA | 7.76E-12 | mr1612 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517819523 | NA | 1.01E-09 | mr1652 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517819523 | NA | 1.18E-18 | mr1855 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517819523 | NA | 6.37E-08 | mr1989 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517819523 | NA | 1.05E-06 | mr1608_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517819523 | NA | 3.59E-12 | mr1610_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517819523 | NA | 1.78E-07 | mr1612_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517819523 | NA | 5.32E-23 | mr1855_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |