\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0517802011:

Variant ID: vg0517802011 (JBrowse)Variation Type: INDEL
Chromosome: chr05Position: 17802011
Reference Allele: ACTTGAlternative Allele: GCTTG,A
Primary Allele: GCTTGSecondary Allele: ACTTG

Inferred Ancestral Allele : ACTTG (evidence from allele frequency in Oryza rufipogon: ACTTG: 0.93, A: 0.08, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


ATATTTGCTCTTCAAAGGGTGTGAACCCATTTGGACAGATCAGACAGTTCCTTCTCTGAATAAGATAGTTGAGATATTGGAGAAGACCATATTACATCTC[ACTTG/GCTTG,A]
AACAATGGAAACAATGTATACTGAAATGATCCGATATGTGTAGCTCACTTCTAGAGATATTTTTTTCCAATTATACAACTCCATATAAAATAAAATGGGA

Reverse complement sequence

TCCCATTTTATTTTATATGGAGTTGTATAATTGGAAAAAAATATCTCTAGAAGTGAGCTACACATATCGGATCATTTCAGTATACATTGTTTCCATTGTT[CAAGT/CAAGC,T]
GAGATGTAATATGGTCTTCTCCAATATCTCAACTATCTTATTCAGAGAAGGAACTGTCTGATCTGTCCAAATGGGTTCACACCCTTTGAAGAGCAAATAT

Allele Frequencies:

Populations Population SizeFrequency of GCTTG(primary allele) Frequency of ACTTG(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.70% 35.60% 0.15% 0.30% A: 5.25%
All Indica  2759 92.00% 6.50% 0.14% 0.29% A: 1.01%
All Japonica  1512 8.90% 90.70% 0.00% 0.26% A: 0.07%
Aus  269 24.50% 0.00% 0.00% 0.00% A: 75.46%
Indica I  595 96.30% 3.70% 0.00% 0.00% NA
Indica II  465 74.60% 24.50% 0.00% 0.65% A: 0.22%
Indica III  913 97.80% 0.70% 0.11% 0.22% A: 1.20%
Indica Intermediate  786 92.40% 4.80% 0.38% 0.38% A: 2.04%
Temperate Japonica  767 2.90% 97.10% 0.00% 0.00% NA
Tropical Japonica  504 21.40% 78.20% 0.00% 0.40% NA
Japonica Intermediate  241 2.10% 96.70% 0.00% 0.83% A: 0.41%
VI/Aromatic  96 0.00% 92.70% 0.00% 0.00% A: 7.29%
Intermediate  90 37.80% 46.70% 3.33% 2.22% A: 10.00%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0517802011 ACTTG -> DEL N N silent_mutation Average:58.787; most accessible tissue: Callus, score: 90.221 N N N N
vg0517802011 ACTTG -> A LOC_Os05g30740.1 downstream_gene_variant ; 1028.0bp to feature; MODIFIER silent_mutation Average:58.787; most accessible tissue: Callus, score: 90.221 N N N N
vg0517802011 ACTTG -> A LOC_Os05g30730-LOC_Os05g30740 intergenic_region ; MODIFIER silent_mutation Average:58.787; most accessible tissue: Callus, score: 90.221 N N N N
vg0517802011 ACTTG -> GCTTG LOC_Os05g30740.1 downstream_gene_variant ; 1029.0bp to feature; MODIFIER silent_mutation Average:58.787; most accessible tissue: Callus, score: 90.221 N N N N
vg0517802011 ACTTG -> GCTTG LOC_Os05g30730-LOC_Os05g30740 intergenic_region ; MODIFIER silent_mutation Average:58.787; most accessible tissue: Callus, score: 90.221 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0517802011 NA 2.70E-07 mr1039 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517802011 NA 1.29E-06 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517802011 NA 3.40E-15 mr1156 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517802011 NA 1.85E-08 mr1342 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517802011 2.27E-06 NA mr1789 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517802011 NA 4.13E-10 mr1827 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517802011 NA 1.67E-06 mr1002_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251