| Variant ID: vg0517802011 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr05 | Position: 17802011 |
| Reference Allele: ACTTG | Alternative Allele: GCTTG,A |
| Primary Allele: GCTTG | Secondary Allele: ACTTG |
Inferred Ancestral Allele : ACTTG (evidence from allele frequency in Oryza rufipogon: ACTTG: 0.93, A: 0.08, others allele: 0.00, population size: 109. )
ATATTTGCTCTTCAAAGGGTGTGAACCCATTTGGACAGATCAGACAGTTCCTTCTCTGAATAAGATAGTTGAGATATTGGAGAAGACCATATTACATCTC[ACTTG/GCTTG,A]
AACAATGGAAACAATGTATACTGAAATGATCCGATATGTGTAGCTCACTTCTAGAGATATTTTTTTCCAATTATACAACTCCATATAAAATAAAATGGGA
TCCCATTTTATTTTATATGGAGTTGTATAATTGGAAAAAAATATCTCTAGAAGTGAGCTACACATATCGGATCATTTCAGTATACATTGTTTCCATTGTT[CAAGT/CAAGC,T]
GAGATGTAATATGGTCTTCTCCAATATCTCAACTATCTTATTCAGAGAAGGAACTGTCTGATCTGTCCAAATGGGTTCACACCCTTTGAAGAGCAAATAT
| Populations | Population Size | Frequency of GCTTG(primary allele) | Frequency of ACTTG(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.70% | 35.60% | 0.15% | 0.30% | A: 5.25% |
| All Indica | 2759 | 92.00% | 6.50% | 0.14% | 0.29% | A: 1.01% |
| All Japonica | 1512 | 8.90% | 90.70% | 0.00% | 0.26% | A: 0.07% |
| Aus | 269 | 24.50% | 0.00% | 0.00% | 0.00% | A: 75.46% |
| Indica I | 595 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 74.60% | 24.50% | 0.00% | 0.65% | A: 0.22% |
| Indica III | 913 | 97.80% | 0.70% | 0.11% | 0.22% | A: 1.20% |
| Indica Intermediate | 786 | 92.40% | 4.80% | 0.38% | 0.38% | A: 2.04% |
| Temperate Japonica | 767 | 2.90% | 97.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 21.40% | 78.20% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 2.10% | 96.70% | 0.00% | 0.83% | A: 0.41% |
| VI/Aromatic | 96 | 0.00% | 92.70% | 0.00% | 0.00% | A: 7.29% |
| Intermediate | 90 | 37.80% | 46.70% | 3.33% | 2.22% | A: 10.00% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0517802011 | ACTTG -> DEL | N | N | silent_mutation | Average:58.787; most accessible tissue: Callus, score: 90.221 | N | N | N | N |
| vg0517802011 | ACTTG -> A | LOC_Os05g30740.1 | downstream_gene_variant ; 1028.0bp to feature; MODIFIER | silent_mutation | Average:58.787; most accessible tissue: Callus, score: 90.221 | N | N | N | N |
| vg0517802011 | ACTTG -> A | LOC_Os05g30730-LOC_Os05g30740 | intergenic_region ; MODIFIER | silent_mutation | Average:58.787; most accessible tissue: Callus, score: 90.221 | N | N | N | N |
| vg0517802011 | ACTTG -> GCTTG | LOC_Os05g30740.1 | downstream_gene_variant ; 1029.0bp to feature; MODIFIER | silent_mutation | Average:58.787; most accessible tissue: Callus, score: 90.221 | N | N | N | N |
| vg0517802011 | ACTTG -> GCTTG | LOC_Os05g30730-LOC_Os05g30740 | intergenic_region ; MODIFIER | silent_mutation | Average:58.787; most accessible tissue: Callus, score: 90.221 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0517802011 | NA | 2.70E-07 | mr1039 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517802011 | NA | 1.29E-06 | mr1044 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517802011 | NA | 3.40E-15 | mr1156 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517802011 | NA | 1.85E-08 | mr1342 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517802011 | 2.27E-06 | NA | mr1789 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517802011 | NA | 4.13E-10 | mr1827 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517802011 | NA | 1.67E-06 | mr1002_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |