Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0517802011:

Variant ID: vg0517802011 (JBrowse)	Variation Type: INDEL
Chromosome: chr05	Position: 17802011
Reference Allele: ACTTG	Alternative Allele: GCTTG,A
Primary Allele: GCTTG	Secondary Allele: ACTTG

Inferred Ancestral Allele : ACTTG (evidence from allele frequency in Oryza rufipogon: ACTTG: 0.93, A: 0.08, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

ATATTTGCTCTTCAAAGGGTGTGAACCCATTTGGACAGATCAGACAGTTCCTTCTCTGAATAAGATAGTTGAGATATTGGAGAAGACCATATTACATCTC[ACTTG/GCTTG,A]
AACAATGGAAACAATGTATACTGAAATGATCCGATATGTGTAGCTCACTTCTAGAGATATTTTTTTCCAATTATACAACTCCATATAAAATAAAATGGGA

Reverse complement sequence

TCCCATTTTATTTTATATGGAGTTGTATAATTGGAAAAAAATATCTCTAGAAGTGAGCTACACATATCGGATCATTTCAGTATACATTGTTTCCATTGTT[CAAGT/CAAGC,T]
GAGATGTAATATGGTCTTCTCCAATATCTCAACTATCTTATTCAGAGAAGGAACTGTCTGATCTGTCCAAATGGGTTCACACCCTTTGAAGAGCAAATAT

Allele Frequencies:

Populations	Population Size	Frequency of GCTTG(primary allele)	Frequency of ACTTG(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.70%	35.60%	0.15%	0.30%	A: 5.25%
All Indica	2759	92.00%	6.50%	0.14%	0.29%	A: 1.01%
All Japonica	1512	8.90%	90.70%	0.00%	0.26%	A: 0.07%
Aus	269	24.50%	0.00%	0.00%	0.00%	A: 75.46%
Indica I	595	96.30%	3.70%	0.00%	0.00%	NA
Indica II	465	74.60%	24.50%	0.00%	0.65%	A: 0.22%
Indica III	913	97.80%	0.70%	0.11%	0.22%	A: 1.20%
Indica Intermediate	786	92.40%	4.80%	0.38%	0.38%	A: 2.04%
Temperate Japonica	767	2.90%	97.10%	0.00%	0.00%	NA
Tropical Japonica	504	21.40%	78.20%	0.00%	0.40%	NA
Japonica Intermediate	241	2.10%	96.70%	0.00%	0.83%	A: 0.41%
VI/Aromatic	96	0.00%	92.70%	0.00%	0.00%	A: 7.29%
Intermediate	90	37.80%	46.70%	3.33%	2.22%	A: 10.00%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0517802011	ACTTG -> DEL	N	N	silent_mutation	Average:58.787; most accessible tissue: Callus, score: 90.221	N	N	N	N
vg0517802011	ACTTG -> A	LOC_Os05g30740.1	downstream_gene_variant ; 1028.0bp to feature; MODIFIER	silent_mutation	Average:58.787; most accessible tissue: Callus, score: 90.221	N	N	N	N
vg0517802011	ACTTG -> A	LOC_Os05g30730-LOC_Os05g30740	intergenic_region ; MODIFIER	silent_mutation	Average:58.787; most accessible tissue: Callus, score: 90.221	N	N	N	N
vg0517802011	ACTTG -> GCTTG	LOC_Os05g30740.1	downstream_gene_variant ; 1029.0bp to feature; MODIFIER	silent_mutation	Average:58.787; most accessible tissue: Callus, score: 90.221	N	N	N	N
vg0517802011	ACTTG -> GCTTG	LOC_Os05g30730-LOC_Os05g30740	intergenic_region ; MODIFIER	silent_mutation	Average:58.787; most accessible tissue: Callus, score: 90.221	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0517802011	NA	2.70E-07	mr1039	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517802011	NA	1.29E-06	mr1044	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517802011	NA	3.40E-15	mr1156	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517802011	NA	1.85E-08	mr1342	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517802011	2.27E-06	NA	mr1789	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517802011	NA	4.13E-10	mr1827	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517802011	NA	1.67E-06	mr1002_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251