\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0517797635:

Variant ID: vg0517797635 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 17797635
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGAAGGAGAGAAATGTCCATATGGGAAAATTGATTTTGTCATGCGGTTCTATTAAGAGGCCCACCTACGAAAATAGCCTATTATCGTAGGTGGGTGTTGG[C/T]
GGCTGTTAAATGTCGATTCTATACCGCCAACATCTGCATAAAGATCAGATAATAAAACATCCAACATAGAGATAGGCACTTAATCTCACATATTCCACAG

Reverse complement sequence

CTGTGGAATATGTGAGATTAAGTGCCTATCTCTATGTTGGATGTTTTATTATCTGATCTTTATGCAGATGTTGGCGGTATAGAATCGACATTTAACAGCC[G/A]
CCAACACCCACCTACGATAATAGGCTATTTTCGTAGGTGGGCCTCTTAATAGAACCGCATGACAAAATCAATTTTCCCATATGGACATTTCTCTCCTTCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.50% 7.70% 3.24% 52.50% NA
All Indica  2759 10.40% 1.90% 4.86% 82.86% NA
All Japonica  1512 83.30% 8.30% 0.66% 7.80% NA
Aus  269 17.10% 63.20% 2.97% 16.73% NA
Indica I  595 3.20% 3.00% 9.08% 84.71% NA
Indica II  465 29.00% 0.40% 4.73% 65.81% NA
Indica III  913 6.00% 1.50% 2.41% 90.03% NA
Indica Intermediate  786 9.80% 2.40% 4.58% 83.21% NA
Temperate Japonica  767 96.10% 1.30% 0.00% 2.61% NA
Tropical Japonica  504 57.90% 21.60% 1.79% 18.65% NA
Japonica Intermediate  241 95.40% 2.50% 0.41% 1.66% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 51.10% 12.20% 1.11% 35.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0517797635 C -> T LOC_Os05g30730.1 upstream_gene_variant ; 2509.0bp to feature; MODIFIER silent_mutation Average:33.354; most accessible tissue: Minghui63 young leaf, score: 48.378 N N N N
vg0517797635 C -> T LOC_Os05g30730-LOC_Os05g30740 intergenic_region ; MODIFIER silent_mutation Average:33.354; most accessible tissue: Minghui63 young leaf, score: 48.378 N N N N
vg0517797635 C -> DEL N N silent_mutation Average:33.354; most accessible tissue: Minghui63 young leaf, score: 48.378 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0517797635 NA 2.49E-06 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517797635 NA 9.64E-07 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517797635 1.67E-06 NA mr1104 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517797635 NA 9.60E-06 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517797635 NA 1.34E-07 mr1230 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517797635 NA 3.60E-11 mr1317 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517797635 NA 2.08E-06 mr1373 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517797635 NA 1.61E-06 mr1417 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517797635 NA 2.94E-06 mr1434 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517797635 NA 8.76E-07 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517797635 NA 7.94E-07 mr1706 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517797635 NA 1.45E-06 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517797635 1.04E-06 NA mr1949 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517797635 6.86E-06 4.70E-07 mr1949 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517797635 NA 9.87E-06 mr1985 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517797635 NA 1.50E-07 mr1989 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517797635 NA 6.15E-06 mr1070_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517797635 2.68E-06 NA mr1083_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517797635 NA 1.23E-08 mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517797635 NA 6.82E-06 mr1085_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517797635 1.77E-07 NA mr1104_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517797635 NA 6.82E-07 mr1104_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517797635 NA 6.33E-06 mr1107_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517797635 3.69E-06 3.69E-06 mr1145_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517797635 8.13E-06 NA mr1226_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517797635 NA 4.49E-07 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517797635 NA 6.73E-12 mr1317_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517797635 NA 1.31E-07 mr1408_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517797635 NA 4.08E-06 mr1437_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517797635 NA 4.13E-08 mr1608_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517797635 NA 2.40E-08 mr1612_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517797635 NA 2.20E-11 mr1818_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251