\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0517791688:

Variant ID: vg0517791688 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 17791688
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGTCATGAGTCTAATTATTAGTATAAATCGCAAATGTACAATTGTCCTGTTAACTGATGTGGTCCCTTGCATTTTTGCATGGGTTCTTATTTATAGTTCT[T/G]
TAAGTTTTTGCCTGTATGATTTGGGACCTAGTGTTATCAACTTGGAACAAAGTATAAAAAAATATGGGAAGGATTCTAGGTGGGCAAGTGGGCATGTAAT

Reverse complement sequence

ATTACATGCCCACTTGCCCACCTAGAATCCTTCCCATATTTTTTTATACTTTGTTCCAAGTTGATAACACTAGGTCCCAAATCATACAGGCAAAAACTTA[A/C]
AGAACTATAAATAAGAACCCATGCAAAAATGCAAGGGACCACATCAGTTAACAGGACAATTGTACATTTGCGATTTATACTAATAATTAGACTCATGACG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.30% 5.10% 1.02% 52.52% NA
All Indica  2759 14.40% 2.00% 1.56% 81.99% NA
All Japonica  1512 91.50% 0.10% 0.20% 8.20% NA
Aus  269 13.80% 61.30% 0.74% 24.16% NA
Indica I  595 15.50% 3.20% 2.18% 79.16% NA
Indica II  465 33.30% 0.40% 1.51% 64.73% NA
Indica III  913 3.30% 1.60% 1.20% 93.87% NA
Indica Intermediate  786 15.40% 2.50% 1.53% 80.53% NA
Temperate Japonica  767 97.40% 0.00% 0.13% 2.48% NA
Tropical Japonica  504 79.80% 0.00% 0.20% 20.04% NA
Japonica Intermediate  241 97.10% 0.80% 0.41% 1.66% NA
VI/Aromatic  96 89.60% 10.40% 0.00% 0.00% NA
Intermediate  90 55.60% 10.00% 0.00% 34.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0517791688 T -> DEL N N silent_mutation Average:9.513; most accessible tissue: Callus, score: 56.024 N N N N
vg0517791688 T -> G LOC_Os05g30720.1 downstream_gene_variant ; 426.0bp to feature; MODIFIER silent_mutation Average:9.513; most accessible tissue: Callus, score: 56.024 N N N N
vg0517791688 T -> G LOC_Os05g30730.1 downstream_gene_variant ; 2008.0bp to feature; MODIFIER silent_mutation Average:9.513; most accessible tissue: Callus, score: 56.024 N N N N
vg0517791688 T -> G LOC_Os05g30720-LOC_Os05g30730 intergenic_region ; MODIFIER silent_mutation Average:9.513; most accessible tissue: Callus, score: 56.024 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0517791688 NA 3.09E-06 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517791688 NA 1.74E-09 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517791688 NA 3.64E-06 mr1052 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517791688 NA 5.21E-27 mr1099 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517791688 NA 1.15E-17 mr1119 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517791688 NA 9.41E-26 mr1123 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517791688 NA 2.39E-06 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517791688 NA 3.08E-07 mr1157 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517791688 NA 1.43E-09 mr1317 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517791688 NA 2.81E-07 mr1328 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517791688 NA 1.18E-08 mr1369 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517791688 NA 1.75E-06 mr1373 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517791688 NA 6.78E-06 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517791688 NA 4.45E-08 mr1446 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517791688 NA 4.12E-10 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517791688 NA 2.55E-17 mr1496 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517791688 NA 9.02E-12 mr1612 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517791688 NA 2.76E-10 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517791688 NA 1.17E-20 mr1855 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517791688 NA 1.37E-25 mr1858 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517791688 NA 1.28E-25 mr1859 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517791688 NA 7.52E-11 mr1927 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517791688 NA 5.77E-10 mr1989 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517791688 NA 2.11E-23 mr1123_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517791688 NA 1.00E-11 mr1317_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517791688 NA 6.41E-14 mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517791688 NA 3.16E-08 mr1608_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517791688 NA 7.45E-13 mr1610_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517791688 NA 1.49E-08 mr1612_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517791688 NA 4.64E-12 mr1818_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517791688 NA 5.50E-26 mr1855_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517791688 NA 3.44E-11 mr1897_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517791688 NA 1.38E-13 mr1914_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517791688 NA 2.32E-17 mr1927_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517791688 NA 2.93E-17 mr1936_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251