| Variant ID: vg0517768647 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr05 | Position: 17768647 |
| Reference Allele: C | Alternative Allele: G,CA |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GACCGCCAAGTGGCGCTCTACCAAATTAAAGAAATTCCAAGAAAAATAAAATATCTAACCATTAATTTTCATTTAATCCGGTGGACCCAAATTTTTTAAC[C/G,CA]
GTTAGATCTAACATAAAAGATACCAAATAGATTTATATTTAGAAAGCGGCACGTTCTTTGTCGATCCATCCCGTACATAGTTCGTACGTATGCTCCCTTC
GAAGGGAGCATACGTACGAACTATGTACGGGATGGATCGACAAAGAACGTGCCGCTTTCTAAATATAAATCTATTTGGTATCTTTTATGTTAGATCTAAC[G/C,TG]
GTTAAAAAATTTGGGTCCACCGGATTAAATGAAAATTAATGGTTAGATATTTTATTTTTCTTGGAATTTCTTTAATTTGGTAGAGCGCCACTTGGCGGTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.40% | 2.40% | 3.36% | 39.80% | CA: 0.02% |
| All Indica | 2759 | 34.40% | 0.10% | 4.93% | 60.57% | NA |
| All Japonica | 1512 | 84.70% | 7.30% | 0.26% | 7.74% | NA |
| Aus | 269 | 71.70% | 0.00% | 4.83% | 23.42% | NA |
| Indica I | 595 | 31.40% | 0.00% | 7.73% | 60.84% | NA |
| Indica II | 465 | 54.40% | 0.00% | 4.95% | 40.65% | NA |
| Indica III | 913 | 23.00% | 0.30% | 2.30% | 74.37% | NA |
| Indica Intermediate | 786 | 38.00% | 0.00% | 5.85% | 56.11% | NA |
| Temperate Japonica | 767 | 96.70% | 0.90% | 0.00% | 2.35% | NA |
| Tropical Japonica | 504 | 60.90% | 19.40% | 0.79% | 18.85% | NA |
| Japonica Intermediate | 241 | 96.30% | 2.10% | 0.00% | 1.66% | NA |
| VI/Aromatic | 96 | 94.80% | 0.00% | 1.04% | 4.17% | NA |
| Intermediate | 90 | 63.30% | 1.10% | 5.56% | 28.89% | CA: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0517768647 | C -> DEL | N | N | silent_mutation | Average:11.442; most accessible tissue: Callus, score: 47.259 | N | N | N | N |
| vg0517768647 | C -> G | LOC_Os05g30680.1 | downstream_gene_variant ; 1111.0bp to feature; MODIFIER | silent_mutation | Average:11.442; most accessible tissue: Callus, score: 47.259 | N | N | N | N |
| vg0517768647 | C -> G | LOC_Os05g30680-LOC_Os05g30690 | intergenic_region ; MODIFIER | silent_mutation | Average:11.442; most accessible tissue: Callus, score: 47.259 | N | N | N | N |
| vg0517768647 | C -> CA | LOC_Os05g30680.1 | downstream_gene_variant ; 1112.0bp to feature; MODIFIER | silent_mutation | Average:11.442; most accessible tissue: Callus, score: 47.259 | N | N | N | N |
| vg0517768647 | C -> CA | LOC_Os05g30680-LOC_Os05g30690 | intergenic_region ; MODIFIER | silent_mutation | Average:11.442; most accessible tissue: Callus, score: 47.259 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0517768647 | 2.49E-07 | NA | mr1038_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517768647 | NA | 1.69E-07 | mr1083_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517768647 | NA | 2.56E-06 | mr1104_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517768647 | NA | 6.33E-06 | mr1408_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |