\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0517761984:

Variant ID: vg0517761984 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 17761984
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


TATTGTAAAAAATGGAGAAAACAATTGAATAGTACAACGTAAATCGTAGTTGATCAAATTTGATGACAATTTAGCAAACTACCATAAATATTGCACATAT[A/G]
AAAGTAAATTACATTGCATTCCATACCACAGAATCATAGAAACAACTTTTTTTACATCACAAGAAATTAGATAATTGTATTGTTCATGACTTAACATCTA

Reverse complement sequence

TAGATGTTAAGTCATGAACAATACAATTATCTAATTTCTTGTGATGTAAAAAAAGTTGTTTCTATGATTCTGTGGTATGGAATGCAATGTAATTTACTTT[T/C]
ATATGTGCAATATTTATGGTAGTTTGCTAAATTGTCATCAAATTTGATCAACTACGATTTACGTTGTACTATTCAATTGTTTTCTCCATTTTTTACAATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 20.70% 16.70% 1.46% 61.19% NA
All Indica  2759 7.50% 1.70% 1.99% 88.84% NA
All Japonica  1512 48.90% 41.90% 0.46% 8.66% NA
Aus  269 1.90% 0.40% 1.86% 95.91% NA
Indica I  595 2.00% 2.20% 2.69% 93.11% NA
Indica II  465 26.00% 1.10% 2.15% 70.75% NA
Indica III  913 3.20% 1.20% 1.10% 94.52% NA
Indica Intermediate  786 5.60% 2.30% 2.42% 89.69% NA
Temperate Japonica  767 25.80% 71.10% 0.52% 2.61% NA
Tropical Japonica  504 69.40% 9.50% 0.40% 20.63% NA
Japonica Intermediate  241 79.70% 17.00% 0.41% 2.90% NA
VI/Aromatic  96 0.00% 88.50% 0.00% 11.46% NA
Intermediate  90 30.00% 22.20% 2.22% 45.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0517761984 A -> DEL N N silent_mutation Average:10.191; most accessible tissue: Callus, score: 44.16 N N N N
vg0517761984 A -> G LOC_Os05g30660.1 upstream_gene_variant ; 2893.0bp to feature; MODIFIER silent_mutation Average:10.191; most accessible tissue: Callus, score: 44.16 N N N N
vg0517761984 A -> G LOC_Os05g30680.1 upstream_gene_variant ; 3728.0bp to feature; MODIFIER silent_mutation Average:10.191; most accessible tissue: Callus, score: 44.16 N N N N
vg0517761984 A -> G LOC_Os05g30670.1 intron_variant ; MODIFIER silent_mutation Average:10.191; most accessible tissue: Callus, score: 44.16 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0517761984 3.29E-06 3.29E-06 mr1181_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517761984 1.49E-06 NA mr1739_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251