\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0517754242:

Variant ID: vg0517754242 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 17754242
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 77. )

Flanking Sequence (100 bp) in Reference Genome:


CCACCCTAACTCTTTTCGCTAGTGATGTCTAGCGTCTCTTTCAACAATAACTCTTTTCGCTAGTGATGCCTAGCGTCTCATTCGACAAAGGTATGGCATG[T/C]
ATATAGGTATGAAAATTTGCTGGCATGTCGTTAATAATTTGCTCGAAGTCATCGAAGAACTGAAGGCGTGGTTTAGGGTGGTCCATTGTGTAACAAAGGT

Reverse complement sequence

ACCTTTGTTACACAATGGACCACCCTAAACCACGCCTTCAGTTCTTCGATGACTTCGAGCAAATTATTAACGACATGCCAGCAAATTTTCATACCTATAT[A/G]
CATGCCATACCTTTGTCGAATGAGACGCTAGGCATCACTAGCGAAAAGAGTTATTGTTGAAAGAGACGCTAGACATCACTAGCGAAAAGAGTTAGGGTGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 24.10% 12.90% 0.19% 62.80% NA
All Indica  2759 7.10% 1.40% 0.33% 91.16% NA
All Japonica  1512 54.30% 36.90% 0.00% 8.80% NA
Aus  269 0.40% 0.40% 0.00% 99.26% NA
Indica I  595 2.70% 2.20% 0.34% 94.79% NA
Indica II  465 26.90% 1.70% 0.65% 70.75% NA
Indica III  913 0.90% 0.50% 0.00% 98.58% NA
Indica Intermediate  786 6.10% 1.50% 0.51% 91.86% NA
Temperate Japonica  767 28.20% 69.20% 0.00% 2.61% NA
Tropical Japonica  504 77.60% 1.40% 0.00% 21.03% NA
Japonica Intermediate  241 88.80% 8.30% 0.00% 2.90% NA
VI/Aromatic  96 88.50% 0.00% 0.00% 11.46% NA
Intermediate  90 40.00% 13.30% 0.00% 46.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0517754242 T -> DEL N N silent_mutation Average:10.536; most accessible tissue: Callus, score: 61.195 N N N N
vg0517754242 T -> C LOC_Os05g30650.1 upstream_gene_variant ; 1308.0bp to feature; MODIFIER silent_mutation Average:10.536; most accessible tissue: Callus, score: 61.195 N N N N
vg0517754242 T -> C LOC_Os05g30640.1 downstream_gene_variant ; 931.0bp to feature; MODIFIER silent_mutation Average:10.536; most accessible tissue: Callus, score: 61.195 N N N N
vg0517754242 T -> C LOC_Os05g30660.1 downstream_gene_variant ; 2717.0bp to feature; MODIFIER silent_mutation Average:10.536; most accessible tissue: Callus, score: 61.195 N N N N
vg0517754242 T -> C LOC_Os05g30640-LOC_Os05g30650 intergenic_region ; MODIFIER silent_mutation Average:10.536; most accessible tissue: Callus, score: 61.195 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0517754242 NA 9.68E-10 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517754242 NA 1.23E-07 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517754242 NA 2.01E-06 mr1826 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517754242 6.86E-06 3.93E-06 mr1245_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517754242 4.21E-06 1.87E-06 mr1445_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517754242 NA 2.42E-09 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517754242 NA 1.28E-08 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517754242 NA 5.70E-09 mr1952_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517754242 NA 2.60E-06 mr1966_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251