Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0517754242:

Variant ID: vg0517754242 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 17754242
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 77. )

Flanking Sequence (100 bp) in Reference Genome:

CCACCCTAACTCTTTTCGCTAGTGATGTCTAGCGTCTCTTTCAACAATAACTCTTTTCGCTAGTGATGCCTAGCGTCTCATTCGACAAAGGTATGGCATG[T/C]
ATATAGGTATGAAAATTTGCTGGCATGTCGTTAATAATTTGCTCGAAGTCATCGAAGAACTGAAGGCGTGGTTTAGGGTGGTCCATTGTGTAACAAAGGT

Reverse complement sequence

ACCTTTGTTACACAATGGACCACCCTAAACCACGCCTTCAGTTCTTCGATGACTTCGAGCAAATTATTAACGACATGCCAGCAAATTTTCATACCTATAT[A/G]
CATGCCATACCTTTGTCGAATGAGACGCTAGGCATCACTAGCGAAAAGAGTTATTGTTGAAAGAGACGCTAGACATCACTAGCGAAAAGAGTTAGGGTGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	24.10%	12.90%	0.19%	62.80%	NA
All Indica	2759	7.10%	1.40%	0.33%	91.16%	NA
All Japonica	1512	54.30%	36.90%	0.00%	8.80%	NA
Aus	269	0.40%	0.40%	0.00%	99.26%	NA
Indica I	595	2.70%	2.20%	0.34%	94.79%	NA
Indica II	465	26.90%	1.70%	0.65%	70.75%	NA
Indica III	913	0.90%	0.50%	0.00%	98.58%	NA
Indica Intermediate	786	6.10%	1.50%	0.51%	91.86%	NA
Temperate Japonica	767	28.20%	69.20%	0.00%	2.61%	NA
Tropical Japonica	504	77.60%	1.40%	0.00%	21.03%	NA
Japonica Intermediate	241	88.80%	8.30%	0.00%	2.90%	NA
VI/Aromatic	96	88.50%	0.00%	0.00%	11.46%	NA
Intermediate	90	40.00%	13.30%	0.00%	46.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0517754242	T -> DEL	N	N	silent_mutation	Average:10.536; most accessible tissue: Callus, score: 61.195	N	N	N	N
vg0517754242	T -> C	LOC_Os05g30650.1	upstream_gene_variant ; 1308.0bp to feature; MODIFIER	silent_mutation	Average:10.536; most accessible tissue: Callus, score: 61.195	N	N	N	N
vg0517754242	T -> C	LOC_Os05g30640.1	downstream_gene_variant ; 931.0bp to feature; MODIFIER	silent_mutation	Average:10.536; most accessible tissue: Callus, score: 61.195	N	N	N	N
vg0517754242	T -> C	LOC_Os05g30660.1	downstream_gene_variant ; 2717.0bp to feature; MODIFIER	silent_mutation	Average:10.536; most accessible tissue: Callus, score: 61.195	N	N	N	N
vg0517754242	T -> C	LOC_Os05g30640-LOC_Os05g30650	intergenic_region ; MODIFIER	silent_mutation	Average:10.536; most accessible tissue: Callus, score: 61.195	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0517754242	NA	9.68E-10	mr1486	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517754242	NA	1.23E-07	mr1543	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517754242	NA	2.01E-06	mr1826	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517754242	6.86E-06	3.93E-06	mr1245_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517754242	4.21E-06	1.87E-06	mr1445_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517754242	NA	2.42E-09	mr1486_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517754242	NA	1.28E-08	mr1543_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517754242	NA	5.70E-09	mr1952_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517754242	NA	2.60E-06	mr1966_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251