\
| Variant ID: vg0517754242 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 17754242 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 77. )
CCACCCTAACTCTTTTCGCTAGTGATGTCTAGCGTCTCTTTCAACAATAACTCTTTTCGCTAGTGATGCCTAGCGTCTCATTCGACAAAGGTATGGCATG[T/C]
ATATAGGTATGAAAATTTGCTGGCATGTCGTTAATAATTTGCTCGAAGTCATCGAAGAACTGAAGGCGTGGTTTAGGGTGGTCCATTGTGTAACAAAGGT
ACCTTTGTTACACAATGGACCACCCTAAACCACGCCTTCAGTTCTTCGATGACTTCGAGCAAATTATTAACGACATGCCAGCAAATTTTCATACCTATAT[A/G]
CATGCCATACCTTTGTCGAATGAGACGCTAGGCATCACTAGCGAAAAGAGTTATTGTTGAAAGAGACGCTAGACATCACTAGCGAAAAGAGTTAGGGTGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 24.10% | 12.90% | 0.19% | 62.80% | NA |
| All Indica | 2759 | 7.10% | 1.40% | 0.33% | 91.16% | NA |
| All Japonica | 1512 | 54.30% | 36.90% | 0.00% | 8.80% | NA |
| Aus | 269 | 0.40% | 0.40% | 0.00% | 99.26% | NA |
| Indica I | 595 | 2.70% | 2.20% | 0.34% | 94.79% | NA |
| Indica II | 465 | 26.90% | 1.70% | 0.65% | 70.75% | NA |
| Indica III | 913 | 0.90% | 0.50% | 0.00% | 98.58% | NA |
| Indica Intermediate | 786 | 6.10% | 1.50% | 0.51% | 91.86% | NA |
| Temperate Japonica | 767 | 28.20% | 69.20% | 0.00% | 2.61% | NA |
| Tropical Japonica | 504 | 77.60% | 1.40% | 0.00% | 21.03% | NA |
| Japonica Intermediate | 241 | 88.80% | 8.30% | 0.00% | 2.90% | NA |
| VI/Aromatic | 96 | 88.50% | 0.00% | 0.00% | 11.46% | NA |
| Intermediate | 90 | 40.00% | 13.30% | 0.00% | 46.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0517754242 | T -> DEL | N | N | silent_mutation | Average:10.536; most accessible tissue: Callus, score: 61.195 | N | N | N | N |
| vg0517754242 | T -> C | LOC_Os05g30650.1 | upstream_gene_variant ; 1308.0bp to feature; MODIFIER | silent_mutation | Average:10.536; most accessible tissue: Callus, score: 61.195 | N | N | N | N |
| vg0517754242 | T -> C | LOC_Os05g30640.1 | downstream_gene_variant ; 931.0bp to feature; MODIFIER | silent_mutation | Average:10.536; most accessible tissue: Callus, score: 61.195 | N | N | N | N |
| vg0517754242 | T -> C | LOC_Os05g30660.1 | downstream_gene_variant ; 2717.0bp to feature; MODIFIER | silent_mutation | Average:10.536; most accessible tissue: Callus, score: 61.195 | N | N | N | N |
| vg0517754242 | T -> C | LOC_Os05g30640-LOC_Os05g30650 | intergenic_region ; MODIFIER | silent_mutation | Average:10.536; most accessible tissue: Callus, score: 61.195 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0517754242 | NA | 9.68E-10 | mr1486 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517754242 | NA | 1.23E-07 | mr1543 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517754242 | NA | 2.01E-06 | mr1826 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517754242 | 6.86E-06 | 3.93E-06 | mr1245_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517754242 | 4.21E-06 | 1.87E-06 | mr1445_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517754242 | NA | 2.42E-09 | mr1486_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517754242 | NA | 1.28E-08 | mr1543_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517754242 | NA | 5.70E-09 | mr1952_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517754242 | NA | 2.60E-06 | mr1966_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |