Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0517752954:

Variant ID: vg0517752954 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 17752954
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.88, G: 0.12, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


AAGATGCCACTGTGGTTTCCTAAACACTCCTCGCAGCTGGCAAGATTCAAGTCAGAATTTCAGAAAACATTTAGACATCAGAAGCTATGGAAGGTCCCCA[A/G]
CCCAAGGCTCAGGCAGAAACTGCGAGAAGCCATCATTGATAAGGTCATTACTGGATACAAAAGGTACCTGGAGGACCATCCGGAGCTGGAGAAATGCAGC

Reverse complement sequence

GCTGCATTTCTCCAGCTCCGGATGGTCCTCCAGGTACCTTTTGTATCCAGTAATGACCTTATCAATGATGGCTTCTCGCAGTTTCTGCCTGAGCCTTGGG[T/C]
TGGGGACCTTCCATAGCTTCTGATGTCTAAATGTTTTCTGAAATTCTGACTTGAATCTTGCCAGCTGCGAGGAGTGTTTAGGAAACCACAGTGGCATCTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.60% 14.40% 19.72% 24.31% NA
All Indica  2759 15.30% 18.80% 30.59% 35.30% NA
All Japonica  1512 92.10% 1.50% 3.11% 3.31% NA
Aus  269 4.80% 43.50% 10.78% 40.89% NA
Indica I  595 11.80% 31.40% 30.59% 26.22% NA
Indica II  465 33.50% 12.50% 22.37% 31.61% NA
Indica III  913 10.30% 11.90% 31.65% 46.11% NA
Indica Intermediate  786 13.00% 21.00% 34.22% 31.81% NA
Temperate Japonica  767 97.70% 0.10% 0.91% 1.30% NA
Tropical Japonica  504 81.20% 3.80% 7.74% 7.34% NA
Japonica Intermediate  241 97.10% 1.20% 0.41% 1.24% NA
VI/Aromatic  96 88.50% 10.40% 1.04% 0.00% NA
Intermediate  90 57.80% 13.30% 12.22% 16.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0517752954 A -> DEL LOC_Os05g30640.1 N frameshift_variant Average:86.593; most accessible tissue: Minghui63 young leaf, score: 92.927 N N N N
vg0517752954 A -> G LOC_Os05g30640.1 missense_variant ; p.Asn471Ser; MODERATE nonsynonymous_codon Average:86.593; most accessible tissue: Minghui63 young leaf, score: 92.927 benign 0.165 TOLERATED 0.35

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0517752954 A G 0.05 0.03 0.03 0.06 0.05 0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0517752954 NA 1.37E-08 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517752954 NA 2.21E-07 mr1044 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517752954 NA 9.05E-11 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517752954 NA 1.82E-06 mr1482 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517752954 NA 1.92E-09 mr1637 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517752954 NA 3.43E-07 mr1785 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517752954 NA 9.13E-06 mr1002_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517752954 NA 6.80E-06 mr1671_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251