Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0517733387:

Variant ID: vg0517733387 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 17733387
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GAGACCTGTCCTTTTCGAAACGAACTTCCAGATTTTCATCACAGAGTTGTGAAACAGAGAGCGAATTGTACTTAAGCTTACTTACAAGCGCGACATCCTT[C/T]
AGCATGAATTTGTCATTGACCTTGATTGTTCCTTTAGCCATCACGCGTCCACTGCTCGCATCCCCAAAAGTGATGGTCTCATCACCGGATGCACGAGTGA

Reverse complement sequence

TCACTCGTGCATCCGGTGATGAGACCATCACTTTTGGGGATGCGAGCAGTGGACGCGTGATGGCTAAAGGAACAATCAAGGTCAATGACAAATTCATGCT[G/A]
AAGGATGTCGCGCTTGTAAGTAAGCTTAAGTACAATTCGCTCTCTGTTTCACAACTCTGTGATGAAAATCTGGAAGTTCGTTTCGAAAAGGACAGGTCTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	48.00%	0.60%	5.23%	46.19%	NA
All Indica	2759	20.20%	0.90%	7.07%	71.84%	NA
All Japonica	1512	91.70%	0.10%	0.13%	8.13%	NA
Aus	269	66.50%	0.70%	15.24%	17.47%	NA
Indica I	595	26.70%	0.50%	4.37%	68.40%	NA
Indica II	465	36.10%	0.00%	6.02%	57.85%	NA
Indica III	913	7.10%	1.50%	9.20%	82.15%	NA
Indica Intermediate	786	21.10%	0.90%	7.25%	70.74%	NA
Temperate Japonica	767	97.50%	0.00%	0.13%	2.35%	NA
Tropical Japonica	504	79.80%	0.00%	0.00%	20.24%	NA
Japonica Intermediate	241	97.90%	0.40%	0.41%	1.24%	NA
VI/Aromatic	96	93.80%	0.00%	6.25%	0.00%	NA
Intermediate	90	61.10%	1.10%	3.33%	34.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0517733387	C -> T	LOC_Os05g30610.1	synonymous_variant ; p.Leu699Leu; LOW	synonymous_codon	Average:12.763; most accessible tissue: Minghui63 young leaf, score: 19.077	N	N	N	N
vg0517733387	C -> DEL	LOC_Os05g30610.1	N	frameshift_variant	Average:12.763; most accessible tissue: Minghui63 young leaf, score: 19.077	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0517733387	NA	6.33E-11	mr1325	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517733387	NA	2.79E-07	mr1680	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517733387	NA	4.51E-07	mr1690	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517733387	NA	6.97E-06	mr1159_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517733387	NA	5.33E-06	mr1159_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517733387	NA	3.09E-06	mr1173_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517733387	NA	2.97E-06	mr1184_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517733387	NA	7.18E-08	mr1186_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517733387	4.47E-06	4.47E-06	mr1267_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517733387	NA	6.53E-07	mr1355_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517733387	NA	1.88E-07	mr1371_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517733387	NA	9.65E-06	mr1371_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517733387	NA	8.49E-06	mr1373_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517733387	NA	6.71E-07	mr1508_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517733387	1.43E-06	NA	mr1616_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517733387	9.13E-07	1.09E-08	mr1616_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517733387	NA	2.21E-06	mr1647_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517733387	NA	2.36E-07	mr1648_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517733387	NA	2.09E-07	mr1648_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517733387	NA	2.35E-08	mr1655_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517733387	NA	3.55E-06	mr1655_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517733387	NA	1.18E-06	mr1669_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517733387	NA	8.56E-06	mr1669_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517733387	NA	7.99E-06	mr1682_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517733387	NA	3.85E-06	mr1706_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517733387	NA	1.00E-11	mr1756_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517733387	NA	4.39E-07	mr1756_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251