\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0517733387:

Variant ID: vg0517733387 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 17733387
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAGACCTGTCCTTTTCGAAACGAACTTCCAGATTTTCATCACAGAGTTGTGAAACAGAGAGCGAATTGTACTTAAGCTTACTTACAAGCGCGACATCCTT[C/T]
AGCATGAATTTGTCATTGACCTTGATTGTTCCTTTAGCCATCACGCGTCCACTGCTCGCATCCCCAAAAGTGATGGTCTCATCACCGGATGCACGAGTGA

Reverse complement sequence

TCACTCGTGCATCCGGTGATGAGACCATCACTTTTGGGGATGCGAGCAGTGGACGCGTGATGGCTAAAGGAACAATCAAGGTCAATGACAAATTCATGCT[G/A]
AAGGATGTCGCGCTTGTAAGTAAGCTTAAGTACAATTCGCTCTCTGTTTCACAACTCTGTGATGAAAATCTGGAAGTTCGTTTCGAAAAGGACAGGTCTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.00% 0.60% 5.23% 46.19% NA
All Indica  2759 20.20% 0.90% 7.07% 71.84% NA
All Japonica  1512 91.70% 0.10% 0.13% 8.13% NA
Aus  269 66.50% 0.70% 15.24% 17.47% NA
Indica I  595 26.70% 0.50% 4.37% 68.40% NA
Indica II  465 36.10% 0.00% 6.02% 57.85% NA
Indica III  913 7.10% 1.50% 9.20% 82.15% NA
Indica Intermediate  786 21.10% 0.90% 7.25% 70.74% NA
Temperate Japonica  767 97.50% 0.00% 0.13% 2.35% NA
Tropical Japonica  504 79.80% 0.00% 0.00% 20.24% NA
Japonica Intermediate  241 97.90% 0.40% 0.41% 1.24% NA
VI/Aromatic  96 93.80% 0.00% 6.25% 0.00% NA
Intermediate  90 61.10% 1.10% 3.33% 34.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0517733387 C -> T LOC_Os05g30610.1 synonymous_variant ; p.Leu699Leu; LOW synonymous_codon Average:12.763; most accessible tissue: Minghui63 young leaf, score: 19.077 N N N N
vg0517733387 C -> DEL LOC_Os05g30610.1 N frameshift_variant Average:12.763; most accessible tissue: Minghui63 young leaf, score: 19.077 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0517733387 NA 6.33E-11 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517733387 NA 2.79E-07 mr1680 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517733387 NA 4.51E-07 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517733387 NA 6.97E-06 mr1159_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517733387 NA 5.33E-06 mr1159_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517733387 NA 3.09E-06 mr1173_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517733387 NA 2.97E-06 mr1184_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517733387 NA 7.18E-08 mr1186_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517733387 4.47E-06 4.47E-06 mr1267_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517733387 NA 6.53E-07 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517733387 NA 1.88E-07 mr1371_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517733387 NA 9.65E-06 mr1371_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517733387 NA 8.49E-06 mr1373_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517733387 NA 6.71E-07 mr1508_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517733387 1.43E-06 NA mr1616_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517733387 9.13E-07 1.09E-08 mr1616_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517733387 NA 2.21E-06 mr1647_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517733387 NA 2.36E-07 mr1648_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517733387 NA 2.09E-07 mr1648_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517733387 NA 2.35E-08 mr1655_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517733387 NA 3.55E-06 mr1655_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517733387 NA 1.18E-06 mr1669_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517733387 NA 8.56E-06 mr1669_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517733387 NA 7.99E-06 mr1682_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517733387 NA 3.85E-06 mr1706_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517733387 NA 1.00E-11 mr1756_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517733387 NA 4.39E-07 mr1756_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251