\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0517675338:

Variant ID: vg0517675338 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 17675338
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TACTCGATACTACCAGGACTATTTGGATCGTATAATACTTGCCTACTTAGTTTTACTTAGAAAAAGGCACACCCGAAGATATAAATACAAGTCCCACTAG[A/G]
AGAAGTGGGAGGCCAAGACAGAACACAAGCCAATACAGATCTAAACAAATACAAAACAACTTCAAACCTCACCAAGTTCATAGTACTCGAGAAATAAGAT

Reverse complement sequence

ATCTTATTTCTCGAGTACTATGAACTTGGTGAGGTTTGAAGTTGTTTTGTATTTGTTTAGATCTGTATTGGCTTGTGTTCTGTCTTGGCCTCCCACTTCT[T/C]
CTAGTGGGACTTGTATTTATATCTTCGGGTGTGCCTTTTTCTAAGTAAAACTAAGTAGGCAAGTATTATACGATCCAAATAGTCCTGGTAGTATCGAGTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.20% 13.80% 0.02% 0.00% NA
All Indica  2759 99.70% 0.30% 0.00% 0.00% NA
All Japonica  1512 57.90% 42.00% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 99.70% 0.30% 0.00% 0.00% NA
Indica Intermediate  786 99.60% 0.40% 0.00% 0.00% NA
Temperate Japonica  767 24.50% 75.40% 0.13% 0.00% NA
Tropical Japonica  504 98.60% 1.40% 0.00% 0.00% NA
Japonica Intermediate  241 79.30% 20.70% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 90.00% 10.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0517675338 A -> G LOC_Os05g30500.1 downstream_gene_variant ; 3756.0bp to feature; MODIFIER silent_mutation Average:54.811; most accessible tissue: Minghui63 root, score: 70.332 N N N N
vg0517675338 A -> G LOC_Os05g30500-LOC_Os05g30510 intergenic_region ; MODIFIER silent_mutation Average:54.811; most accessible tissue: Minghui63 root, score: 70.332 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0517675338 NA 3.68E-06 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517675338 NA 2.89E-07 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517675338 NA 2.45E-15 mr1013_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517675338 NA 6.77E-07 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517675338 NA 1.78E-06 mr1064_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517675338 NA 3.84E-06 mr1159_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517675338 NA 3.44E-07 mr1544_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517675338 NA 1.22E-10 mr1864_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517675338 NA 1.68E-09 mr1952_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517675338 NA 1.15E-11 mr1952_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517675338 NA 5.57E-07 mr1966_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251