Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0517655898:

Variant ID: vg0517655898 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 17655898
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 327. )

Flanking Sequence (100 bp) in Reference Genome:

TGTATTGCCTAAACATATTTTGAGGATACAAATCAATGCAAAAGATTAGGATATCATAACAATCCTTTGAGATCTCTATATATATCAGTTTGCGTGAGCA[C/T]
TTCTTGCTTACAACGAAACATAGGAAGATACATACAAAGTAGAAGAAAAATGGCATCGATGTCCTACTTCATCGTTGCTATGCTCATATCCAATTGCTTG

Reverse complement sequence

CAAGCAATTGGATATGAGCATAGCAACGATGAAGTAGGACATCGATGCCATTTTTCTTCTACTTTGTATGTATCTTCCTATGTTTCGTTGTAAGCAAGAA[G/A]
TGCTCACGCAAACTGATATATATAGAGATCTCAAAGGATTGTTATGATATCCTAATCTTTTGCATTGATTTGTATCCTCAAAATATGTTTAGGCAATACA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	97.40%	2.50%	0.11%	0.00%	NA
All Indica	2759	100.00%	0.00%	0.00%	0.00%	NA
All Japonica	1512	92.10%	7.50%	0.33%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.90%	0.10%	0.00%	0.00%	NA
Temperate Japonica	767	99.70%	0.00%	0.26%	0.00%	NA
Tropical Japonica	504	77.20%	22.20%	0.60%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	95.60%	4.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0517655898	C -> T	LOC_Os05g30470.1	upstream_gene_variant ; 36.0bp to feature; MODIFIER	silent_mutation	Average:41.85; most accessible tissue: Zhenshan97 young leaf, score: 63.096	N	N	N	N
vg0517655898	C -> T	LOC_Os05g30480.1	downstream_gene_variant ; 3699.0bp to feature; MODIFIER	silent_mutation	Average:41.85; most accessible tissue: Zhenshan97 young leaf, score: 63.096	N	N	N	N
vg0517655898	C -> T	LOC_Os05g30454-LOC_Os05g30470	intergenic_region ; MODIFIER	silent_mutation	Average:41.85; most accessible tissue: Zhenshan97 young leaf, score: 63.096	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0517655898	NA	4.14E-07	mr1076	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517655898	NA	9.31E-07	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517655898	NA	2.59E-07	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517655898	NA	3.01E-06	mr1226	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517655898	8.46E-06	2.92E-09	mr1082_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517655898	6.75E-07	4.52E-10	mr1083_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517655898	NA	9.45E-06	mr1103_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517655898	NA	1.55E-06	mr1104_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517655898	NA	1.25E-06	mr1107_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517655898	NA	7.51E-08	mr1226_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517655898	NA	4.15E-07	mr1408_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251