\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0517640242:

Variant ID: vg0517640242 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 17640242
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


TGACTAGAAGTAAAAACTAGCTTTTCTAGTGGTTGAAAATATTGGTAGTAGTTGAAACATACTACCTCCGTTTTTTTTAATAGATGACGCCGCTGATTTT[A/T]
AGGCACATGTTTGACCATTCATCTTATTCAAAAAATTTACGTAATTACTACCTCTGATTTTTAATAGATGAGTTGACTTTTTATCACACGTTTGACCATT

Reverse complement sequence

AATGGTCAAACGTGTGATAAAAAGTCAACTCATCTATTAAAAATCAGAGGTAGTAATTACGTAAATTTTTTGAATAAGATGAATGGTCAAACATGTGCCT[T/A]
AAAATCAGCGGCGTCATCTATTAAAAAAAACGGAGGTAGTATGTTTCAACTACTACCAATATTTTCAACCACTAGAAAAGCTAGTTTTTACTTCTAGTCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.30% 13.70% 0.02% 0.00% NA
All Indica  2759 99.80% 0.20% 0.00% 0.00% NA
All Japonica  1512 58.00% 42.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 99.70% 0.30% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.10% 0.00% 0.00% NA
Temperate Japonica  767 24.40% 75.60% 0.00% 0.00% NA
Tropical Japonica  504 99.00% 1.00% 0.00% 0.00% NA
Japonica Intermediate  241 79.30% 20.70% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 91.10% 7.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0517640242 A -> T LOC_Os05g30440.1 upstream_gene_variant ; 1265.0bp to feature; MODIFIER silent_mutation Average:36.281; most accessible tissue: Callus, score: 63.311 N N N N
vg0517640242 A -> T LOC_Os05g30454.1 downstream_gene_variant ; 4602.0bp to feature; MODIFIER silent_mutation Average:36.281; most accessible tissue: Callus, score: 63.311 N N N N
vg0517640242 A -> T LOC_Os05g30430.1 intron_variant ; MODIFIER silent_mutation Average:36.281; most accessible tissue: Callus, score: 63.311 N N N N
vg0517640242 A -> T LOC_Os05g30430.2 intron_variant ; MODIFIER silent_mutation Average:36.281; most accessible tissue: Callus, score: 63.311 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0517640242 NA 8.48E-06 mr1534 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517640242 NA 2.01E-06 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517640242 NA 3.78E-06 mr1064_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517640242 NA 1.91E-07 mr1308_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517640242 NA 7.16E-06 mr1544_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517640242 NA 2.29E-06 mr1730_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517640242 NA 7.71E-13 mr1853_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517640242 NA 6.36E-07 mr1853_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517640242 NA 6.04E-11 mr1864_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517640242 NA 4.16E-08 mr1952_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517640242 NA 4.80E-11 mr1952_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517640242 NA 4.66E-06 mr1966_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251