\
| Variant ID: vg0517577873 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 17577873 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.85, A: 0.14, others allele: 0.00, population size: 76. )
AACAAATCGTAGAGAAAGGAAAGAAAACAAATCAGGGAGAAAGGAAAGAGATGCCTCGGTGCGACAGAAAGGAAAGAGATGGCTCGATCTGATCCCGGCG[G/A]
AAATCAGAGACCCCTTCTCCCTCGATACGCGAAATTACCCCCCCGCACGCGCGTGGTACCCCGCTACCAATCCAACCTTAGCCGTGGCAGATCGACGGTA
TACCGTCGATCTGCCACGGCTAAGGTTGGATTGGTAGCGGGGTACCACGCGCGTGCGGGGGGGTAATTTCGCGTATCGAGGGAGAAGGGGTCTCTGATTT[C/T]
CGCCGGGATCAGATCGAGCCATCTCTTTCCTTTCTGTCGCACCGAGGCATCTCTTTCCTTTCTCCCTGATTTGTTTTCTTTCCTTTCTCTACGATTTGTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 76.00% | 23.80% | 0.15% | 0.00% | NA |
| All Indica | 2759 | 94.70% | 5.20% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 42.10% | 57.70% | 0.20% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 76.60% | 23.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.50% | 0.30% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 95.90% | 4.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 63.20% | 36.60% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 24.40% | 75.40% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 12.00% | 87.60% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 12.50% | 86.50% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 67.80% | 31.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0517577873 | G -> A | LOC_Os05g30320.1 | upstream_gene_variant ; 833.0bp to feature; MODIFIER | silent_mutation | Average:62.696; most accessible tissue: Zhenshan97 young leaf, score: 82.077 | N | N | N | N |
| vg0517577873 | G -> A | LOC_Os05g30340.1 | upstream_gene_variant ; 3386.0bp to feature; MODIFIER | silent_mutation | Average:62.696; most accessible tissue: Zhenshan97 young leaf, score: 82.077 | N | N | N | N |
| vg0517577873 | G -> A | LOC_Os05g30310.1 | downstream_gene_variant ; 949.0bp to feature; MODIFIER | silent_mutation | Average:62.696; most accessible tissue: Zhenshan97 young leaf, score: 82.077 | N | N | N | N |
| vg0517577873 | G -> A | LOC_Os05g30310-LOC_Os05g30320 | intergenic_region ; MODIFIER | silent_mutation | Average:62.696; most accessible tissue: Zhenshan97 young leaf, score: 82.077 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0517577873 | NA | 1.43E-06 | mr1044 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517577873 | NA | 6.35E-06 | mr1415 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517577873 | NA | 9.72E-06 | mr1482 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517577873 | NA | 6.35E-06 | mr1567 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517577873 | NA | 3.66E-06 | mr1002_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517577873 | NA | 3.06E-07 | mr1167_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517577873 | NA | 2.71E-07 | mr1408_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517577873 | 2.79E-06 | NA | mr1806_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |