\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0517577873:

Variant ID: vg0517577873 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 17577873
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.85, A: 0.14, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:


AACAAATCGTAGAGAAAGGAAAGAAAACAAATCAGGGAGAAAGGAAAGAGATGCCTCGGTGCGACAGAAAGGAAAGAGATGGCTCGATCTGATCCCGGCG[G/A]
AAATCAGAGACCCCTTCTCCCTCGATACGCGAAATTACCCCCCCGCACGCGCGTGGTACCCCGCTACCAATCCAACCTTAGCCGTGGCAGATCGACGGTA

Reverse complement sequence

TACCGTCGATCTGCCACGGCTAAGGTTGGATTGGTAGCGGGGTACCACGCGCGTGCGGGGGGGTAATTTCGCGTATCGAGGGAGAAGGGGTCTCTGATTT[C/T]
CGCCGGGATCAGATCGAGCCATCTCTTTCCTTTCTGTCGCACCGAGGCATCTCTTTCCTTTCTCCCTGATTTGTTTTCTTTCCTTTCTCTACGATTTGTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.00% 23.80% 0.15% 0.00% NA
All Indica  2759 94.70% 5.20% 0.07% 0.00% NA
All Japonica  1512 42.10% 57.70% 0.20% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 76.60% 23.40% 0.00% 0.00% NA
Indica III  913 99.50% 0.30% 0.22% 0.00% NA
Indica Intermediate  786 95.90% 4.10% 0.00% 0.00% NA
Temperate Japonica  767 63.20% 36.60% 0.13% 0.00% NA
Tropical Japonica  504 24.40% 75.40% 0.20% 0.00% NA
Japonica Intermediate  241 12.00% 87.60% 0.41% 0.00% NA
VI/Aromatic  96 12.50% 86.50% 1.04% 0.00% NA
Intermediate  90 67.80% 31.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0517577873 G -> A LOC_Os05g30320.1 upstream_gene_variant ; 833.0bp to feature; MODIFIER silent_mutation Average:62.696; most accessible tissue: Zhenshan97 young leaf, score: 82.077 N N N N
vg0517577873 G -> A LOC_Os05g30340.1 upstream_gene_variant ; 3386.0bp to feature; MODIFIER silent_mutation Average:62.696; most accessible tissue: Zhenshan97 young leaf, score: 82.077 N N N N
vg0517577873 G -> A LOC_Os05g30310.1 downstream_gene_variant ; 949.0bp to feature; MODIFIER silent_mutation Average:62.696; most accessible tissue: Zhenshan97 young leaf, score: 82.077 N N N N
vg0517577873 G -> A LOC_Os05g30310-LOC_Os05g30320 intergenic_region ; MODIFIER silent_mutation Average:62.696; most accessible tissue: Zhenshan97 young leaf, score: 82.077 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0517577873 NA 1.43E-06 mr1044 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517577873 NA 6.35E-06 mr1415 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517577873 NA 9.72E-06 mr1482 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517577873 NA 6.35E-06 mr1567 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517577873 NA 3.66E-06 mr1002_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517577873 NA 3.06E-07 mr1167_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517577873 NA 2.71E-07 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517577873 2.79E-06 NA mr1806_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251