Search for Variation information by Variation ID:
Detailed information for vg0517398477:
| Variant ID: vg0517398477 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 17398477 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
GGTCTTTCGGACCTTCTTGCGGACAGGCTGCTGATGGTTGCTTGCTTGCTGAGCGTCGAACTCCTTGCGGAGGGCTTGCACTTCTTCGACAGCCATCACA[A/G]
CTTTGCCCGCACGGTCGGTTCTGAACTTCCTCCAGGTCATGGGGGCTTGACCTTGCCTTGGTGGTTGTGCTTGGACCGCCGGCTGGGGCTGGCGAACAAC
Reverse complement sequence
GTTGTTCGCCAGCCCCAGCCGGCGGTCCAAGCACAACCACCAAGGCAAGGTCAAGCCCCCATGACCTGGAGGAAGTTCAGAACCGACCGTGCGGGCAAAG[T/C]
TGTGATGGCTGTCGAAGAAGTGCAAGCCCTCCGCAAGGAGTTCGACGCTCAGCAAGCAAGCAACCATCAGCAGCCTGTCCGCAAGAAGGTCCGAAAGACC
Allele Frequencies:
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.70% | 31.20% | 0.06% | 0.02% | NA |
| All Indica | 2759 | 98.50% | 1.30% | 0.11% | 0.04% | NA |
| All Japonica | 1512 | 13.00% | 87.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.50% | 1.00% | 0.34% | 0.17% | NA |
| Indica II | 465 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.10% | 1.80% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 3.70% | 96.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 30.60% | 69.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 5.80% | 94.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 9.40% | 90.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 61.10% | 38.90% | 0.00% | 0.00% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0517398477 | A -> DEL | LOC_Os05g30070.1 | N | frameshift_variant | Average:21.652; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg0517398477 | A -> G | LOC_Os05g30070.1 | missense_variant ; p.Val398Ala; MODERATE | nonsynonymous_codon ; V398A | Average:21.652; most accessible tissue: Minghui63 panicle, score: 42.799 | possibly damaging  |
-1.585 |
TOLERATED | 1.00 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0517398477 | 7.23E-06 | 7.23E-06 | mr1581 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517398477 | NA | 1.89E-21 | mr1588 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517398477 | NA | 3.65E-10 | mr1630 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517398477 | NA | 8.24E-06 | mr1704 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517398477 | NA | 2.54E-12 | mr1741 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517398477 | NA | 5.14E-07 | mr1785 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |