\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0517394193:

Variant ID: vg0517394193 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 17394193
Reference Allele: AAlternative Allele: T,C
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.90, A: 0.10, others allele: 0.00, population size: 173. )

Flanking Sequence (100 bp) in Reference Genome:


AAAGAAGGCAGAGGACACAAAGATTTTATACTGGTTCGGGCCTCCGTGGTGGATAATAGCTCTACATCTAGTTTTTTTTTTGTCTTTTTTCATTTTCCTC[A/T,C]
TTTTTTTCTTTTTTTCTTGCCAAAAGGCTTACATAGTGCCGAAGGGCTTACATAGTGCCGAAGGGCTTACATAACGATATATACATTTTTACAAGTTTGG

Reverse complement sequence

CCAAACTTGTAAAAATGTATATATCGTTATGTAAGCCCTTCGGCACTATGTAAGCCCTTCGGCACTATGTAAGCCTTTTGGCAAGAAAAAAAGAAAAAAA[T/A,G]
GAGGAAAATGAAAAAAGACAAAAAAAAAACTAGATGTAGAGCTATTATCCACCACGGAGGCCCGAACCAGTATAAAATCTTTGTGTCCTCTGCCTTCTTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.20% 28.40% 2.58% 1.69% C: 0.06%
All Indica  2759 98.20% 1.10% 0.54% 0.04% C: 0.11%
All Japonica  1512 13.00% 78.90% 2.98% 5.16% NA
Aus  269 77.30% 0.40% 22.30% 0.00% NA
Indica I  595 98.00% 0.50% 1.51% 0.00% NA
Indica II  465 98.70% 1.10% 0.00% 0.22% NA
Indica III  913 98.50% 1.10% 0.22% 0.00% C: 0.22%
Indica Intermediate  786 97.80% 1.50% 0.51% 0.00% C: 0.13%
Temperate Japonica  767 3.70% 84.40% 3.26% 8.74% NA
Tropical Japonica  504 30.60% 67.90% 0.79% 0.79% NA
Japonica Intermediate  241 5.80% 84.60% 6.64% 2.90% NA
VI/Aromatic  96 8.30% 90.60% 1.04% 0.00% NA
Intermediate  90 62.20% 35.60% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0517394193 A -> T LOC_Os05g30060.1 downstream_gene_variant ; 1505.0bp to feature; MODIFIER silent_mutation Average:44.617; most accessible tissue: Minghui63 young leaf, score: 70.038 N N N N
vg0517394193 A -> T LOC_Os05g30070.1 downstream_gene_variant ; 121.0bp to feature; MODIFIER silent_mutation Average:44.617; most accessible tissue: Minghui63 young leaf, score: 70.038 N N N N
vg0517394193 A -> T LOC_Os05g30060-LOC_Os05g30070 intergenic_region ; MODIFIER silent_mutation Average:44.617; most accessible tissue: Minghui63 young leaf, score: 70.038 N N N N
vg0517394193 A -> DEL N N silent_mutation Average:44.617; most accessible tissue: Minghui63 young leaf, score: 70.038 N N N N
vg0517394193 A -> C LOC_Os05g30060.1 downstream_gene_variant ; 1505.0bp to feature; MODIFIER silent_mutation Average:44.617; most accessible tissue: Minghui63 young leaf, score: 70.038 N N N N
vg0517394193 A -> C LOC_Os05g30070.1 downstream_gene_variant ; 121.0bp to feature; MODIFIER silent_mutation Average:44.617; most accessible tissue: Minghui63 young leaf, score: 70.038 N N N N
vg0517394193 A -> C LOC_Os05g30060-LOC_Os05g30070 intergenic_region ; MODIFIER silent_mutation Average:44.617; most accessible tissue: Minghui63 young leaf, score: 70.038 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0517394193 NA 1.52E-20 mr1541 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517394193 NA 8.98E-20 mr1588 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517394193 NA 6.41E-69 mr1865 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517394193 NA 6.87E-41 mr1873 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517394193 NA 3.15E-11 mr1722_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251