Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0517394193:

Variant ID: vg0517394193 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 17394193
Reference Allele: A	Alternative Allele: T,C
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.90, A: 0.10, others allele: 0.00, population size: 173. )

Flanking Sequence (100 bp) in Reference Genome:

AAAGAAGGCAGAGGACACAAAGATTTTATACTGGTTCGGGCCTCCGTGGTGGATAATAGCTCTACATCTAGTTTTTTTTTTGTCTTTTTTCATTTTCCTC[A/T,C]
TTTTTTTCTTTTTTTCTTGCCAAAAGGCTTACATAGTGCCGAAGGGCTTACATAGTGCCGAAGGGCTTACATAACGATATATACATTTTTACAAGTTTGG

Reverse complement sequence

CCAAACTTGTAAAAATGTATATATCGTTATGTAAGCCCTTCGGCACTATGTAAGCCCTTCGGCACTATGTAAGCCTTTTGGCAAGAAAAAAAGAAAAAAA[T/A,G]
GAGGAAAATGAAAAAAGACAAAAAAAAAACTAGATGTAGAGCTATTATCCACCACGGAGGCCCGAACCAGTATAAAATCTTTGTGTCCTCTGCCTTCTTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.20%	28.40%	2.58%	1.69%	C: 0.06%
All Indica	2759	98.20%	1.10%	0.54%	0.04%	C: 0.11%
All Japonica	1512	13.00%	78.90%	2.98%	5.16%	NA
Aus	269	77.30%	0.40%	22.30%	0.00%	NA
Indica I	595	98.00%	0.50%	1.51%	0.00%	NA
Indica II	465	98.70%	1.10%	0.00%	0.22%	NA
Indica III	913	98.50%	1.10%	0.22%	0.00%	C: 0.22%
Indica Intermediate	786	97.80%	1.50%	0.51%	0.00%	C: 0.13%
Temperate Japonica	767	3.70%	84.40%	3.26%	8.74%	NA
Tropical Japonica	504	30.60%	67.90%	0.79%	0.79%	NA
Japonica Intermediate	241	5.80%	84.60%	6.64%	2.90%	NA
VI/Aromatic	96	8.30%	90.60%	1.04%	0.00%	NA
Intermediate	90	62.20%	35.60%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0517394193	A -> T	LOC_Os05g30060.1	downstream_gene_variant ; 1505.0bp to feature; MODIFIER	silent_mutation	Average:44.617; most accessible tissue: Minghui63 young leaf, score: 70.038	N	N	N	N
vg0517394193	A -> T	LOC_Os05g30070.1	downstream_gene_variant ; 121.0bp to feature; MODIFIER	silent_mutation	Average:44.617; most accessible tissue: Minghui63 young leaf, score: 70.038	N	N	N	N
vg0517394193	A -> T	LOC_Os05g30060-LOC_Os05g30070	intergenic_region ; MODIFIER	silent_mutation	Average:44.617; most accessible tissue: Minghui63 young leaf, score: 70.038	N	N	N	N
vg0517394193	A -> DEL	N	N	silent_mutation	Average:44.617; most accessible tissue: Minghui63 young leaf, score: 70.038	N	N	N	N
vg0517394193	A -> C	LOC_Os05g30060.1	downstream_gene_variant ; 1505.0bp to feature; MODIFIER	silent_mutation	Average:44.617; most accessible tissue: Minghui63 young leaf, score: 70.038	N	N	N	N
vg0517394193	A -> C	LOC_Os05g30070.1	downstream_gene_variant ; 121.0bp to feature; MODIFIER	silent_mutation	Average:44.617; most accessible tissue: Minghui63 young leaf, score: 70.038	N	N	N	N
vg0517394193	A -> C	LOC_Os05g30060-LOC_Os05g30070	intergenic_region ; MODIFIER	silent_mutation	Average:44.617; most accessible tissue: Minghui63 young leaf, score: 70.038	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0517394193	NA	1.52E-20	mr1541	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517394193	NA	8.98E-20	mr1588	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517394193	NA	6.41E-69	mr1865	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517394193	NA	6.87E-41	mr1873	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517394193	NA	3.15E-11	mr1722_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251