\
| Variant ID: vg0517394193 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 17394193 |
| Reference Allele: A | Alternative Allele: T,C |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.90, A: 0.10, others allele: 0.00, population size: 173. )
AAAGAAGGCAGAGGACACAAAGATTTTATACTGGTTCGGGCCTCCGTGGTGGATAATAGCTCTACATCTAGTTTTTTTTTTGTCTTTTTTCATTTTCCTC[A/T,C]
TTTTTTTCTTTTTTTCTTGCCAAAAGGCTTACATAGTGCCGAAGGGCTTACATAGTGCCGAAGGGCTTACATAACGATATATACATTTTTACAAGTTTGG
CCAAACTTGTAAAAATGTATATATCGTTATGTAAGCCCTTCGGCACTATGTAAGCCCTTCGGCACTATGTAAGCCTTTTGGCAAGAAAAAAAGAAAAAAA[T/A,G]
GAGGAAAATGAAAAAAGACAAAAAAAAAACTAGATGTAGAGCTATTATCCACCACGGAGGCCCGAACCAGTATAAAATCTTTGTGTCCTCTGCCTTCTTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.20% | 28.40% | 2.58% | 1.69% | C: 0.06% |
| All Indica | 2759 | 98.20% | 1.10% | 0.54% | 0.04% | C: 0.11% |
| All Japonica | 1512 | 13.00% | 78.90% | 2.98% | 5.16% | NA |
| Aus | 269 | 77.30% | 0.40% | 22.30% | 0.00% | NA |
| Indica I | 595 | 98.00% | 0.50% | 1.51% | 0.00% | NA |
| Indica II | 465 | 98.70% | 1.10% | 0.00% | 0.22% | NA |
| Indica III | 913 | 98.50% | 1.10% | 0.22% | 0.00% | C: 0.22% |
| Indica Intermediate | 786 | 97.80% | 1.50% | 0.51% | 0.00% | C: 0.13% |
| Temperate Japonica | 767 | 3.70% | 84.40% | 3.26% | 8.74% | NA |
| Tropical Japonica | 504 | 30.60% | 67.90% | 0.79% | 0.79% | NA |
| Japonica Intermediate | 241 | 5.80% | 84.60% | 6.64% | 2.90% | NA |
| VI/Aromatic | 96 | 8.30% | 90.60% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 62.20% | 35.60% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0517394193 | A -> T | LOC_Os05g30060.1 | downstream_gene_variant ; 1505.0bp to feature; MODIFIER | silent_mutation | Average:44.617; most accessible tissue: Minghui63 young leaf, score: 70.038 | N | N | N | N |
| vg0517394193 | A -> T | LOC_Os05g30070.1 | downstream_gene_variant ; 121.0bp to feature; MODIFIER | silent_mutation | Average:44.617; most accessible tissue: Minghui63 young leaf, score: 70.038 | N | N | N | N |
| vg0517394193 | A -> T | LOC_Os05g30060-LOC_Os05g30070 | intergenic_region ; MODIFIER | silent_mutation | Average:44.617; most accessible tissue: Minghui63 young leaf, score: 70.038 | N | N | N | N |
| vg0517394193 | A -> DEL | N | N | silent_mutation | Average:44.617; most accessible tissue: Minghui63 young leaf, score: 70.038 | N | N | N | N |
| vg0517394193 | A -> C | LOC_Os05g30060.1 | downstream_gene_variant ; 1505.0bp to feature; MODIFIER | silent_mutation | Average:44.617; most accessible tissue: Minghui63 young leaf, score: 70.038 | N | N | N | N |
| vg0517394193 | A -> C | LOC_Os05g30070.1 | downstream_gene_variant ; 121.0bp to feature; MODIFIER | silent_mutation | Average:44.617; most accessible tissue: Minghui63 young leaf, score: 70.038 | N | N | N | N |
| vg0517394193 | A -> C | LOC_Os05g30060-LOC_Os05g30070 | intergenic_region ; MODIFIER | silent_mutation | Average:44.617; most accessible tissue: Minghui63 young leaf, score: 70.038 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0517394193 | NA | 1.52E-20 | mr1541 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517394193 | NA | 8.98E-20 | mr1588 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517394193 | NA | 6.41E-69 | mr1865 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517394193 | NA | 6.87E-41 | mr1873 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517394193 | NA | 3.15E-11 | mr1722_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |