\
| Variant ID: vg0517263483 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 17263483 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CGTATAGTACCTGTTCCTCATCGCGATCAGCCATCTGTGCATACAAAAAATATTTGTTAGGTATATAGGATGTATTTGCTAACCGTAATATTAAAACTCT[A/T]
CTAATCTTATATTAAATCTTTAATAATCTTATATTAAAATTTTAATAATCATATATGCTAAGTCTAACAATCTTATATTAAATCGCTACTAATCTCATAT
ATATGAGATTAGTAGCGATTTAATATAAGATTGTTAGACTTAGCATATATGATTATTAAAATTTTAATATAAGATTATTAAAGATTTAATATAAGATTAG[T/A]
AGAGTTTTAATATTACGGTTAGCAAATACATCCTATATACCTAACAAATATTTTTTGTATGCACAGATGGCTGATCGCGATGAGGAACAGGTACTATACG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.80% | 33.40% | 0.74% | 0.00% | NA |
| All Indica | 2759 | 95.80% | 3.10% | 1.09% | 0.00% | NA |
| All Japonica | 1512 | 9.50% | 90.40% | 0.07% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.40% | 0.37% | 0.00% | NA |
| Indica I | 595 | 96.30% | 2.70% | 1.01% | 0.00% | NA |
| Indica II | 465 | 95.30% | 3.00% | 1.72% | 0.00% | NA |
| Indica III | 913 | 96.80% | 2.70% | 0.44% | 0.00% | NA |
| Indica Intermediate | 786 | 94.50% | 3.90% | 1.53% | 0.00% | NA |
| Temperate Japonica | 767 | 2.90% | 97.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 21.80% | 78.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 5.00% | 95.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 7.30% | 92.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 55.60% | 41.10% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0517263483 | A -> T | LOC_Os05g29820.1 | upstream_gene_variant ; 67.0bp to feature; MODIFIER | silent_mutation | Average:19.404; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg0517263483 | A -> T | LOC_Os05g29829.1 | upstream_gene_variant ; 3586.0bp to feature; MODIFIER | silent_mutation | Average:19.404; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg0517263483 | A -> T | LOC_Os05g29840.1 | downstream_gene_variant ; 4752.0bp to feature; MODIFIER | silent_mutation | Average:19.404; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg0517263483 | A -> T | LOC_Os05g29820-LOC_Os05g29829 | intergenic_region ; MODIFIER | silent_mutation | Average:19.404; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0517263483 | 4.07E-06 | 4.06E-06 | mr1279 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |