Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0517263483:

Variant ID: vg0517263483 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 17263483
Reference Allele: A	Alternative Allele: T
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGTATAGTACCTGTTCCTCATCGCGATCAGCCATCTGTGCATACAAAAAATATTTGTTAGGTATATAGGATGTATTTGCTAACCGTAATATTAAAACTCT[A/T]
CTAATCTTATATTAAATCTTTAATAATCTTATATTAAAATTTTAATAATCATATATGCTAAGTCTAACAATCTTATATTAAATCGCTACTAATCTCATAT

Reverse complement sequence

ATATGAGATTAGTAGCGATTTAATATAAGATTGTTAGACTTAGCATATATGATTATTAAAATTTTAATATAAGATTATTAAAGATTTAATATAAGATTAG[T/A]
AGAGTTTTAATATTACGGTTAGCAAATACATCCTATATACCTAACAAATATTTTTTGTATGCACAGATGGCTGATCGCGATGAGGAACAGGTACTATACG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.80%	33.40%	0.74%	0.00%	NA
All Indica	2759	95.80%	3.10%	1.09%	0.00%	NA
All Japonica	1512	9.50%	90.40%	0.07%	0.00%	NA
Aus	269	99.30%	0.40%	0.37%	0.00%	NA
Indica I	595	96.30%	2.70%	1.01%	0.00%	NA
Indica II	465	95.30%	3.00%	1.72%	0.00%	NA
Indica III	913	96.80%	2.70%	0.44%	0.00%	NA
Indica Intermediate	786	94.50%	3.90%	1.53%	0.00%	NA
Temperate Japonica	767	2.90%	97.00%	0.13%	0.00%	NA
Tropical Japonica	504	21.80%	78.20%	0.00%	0.00%	NA
Japonica Intermediate	241	5.00%	95.00%	0.00%	0.00%	NA
VI/Aromatic	96	7.30%	92.70%	0.00%	0.00%	NA
Intermediate	90	55.60%	41.10%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0517263483	A -> T	LOC_Os05g29820.1	upstream_gene_variant ; 67.0bp to feature; MODIFIER	silent_mutation	Average:19.404; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg0517263483	A -> T	LOC_Os05g29829.1	upstream_gene_variant ; 3586.0bp to feature; MODIFIER	silent_mutation	Average:19.404; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg0517263483	A -> T	LOC_Os05g29840.1	downstream_gene_variant ; 4752.0bp to feature; MODIFIER	silent_mutation	Average:19.404; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg0517263483	A -> T	LOC_Os05g29820-LOC_Os05g29829	intergenic_region ; MODIFIER	silent_mutation	Average:19.404; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0517263483	4.07E-06	4.06E-06	mr1279	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251