\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0517199333:

Variant ID: vg0517199333 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 17199333
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 61. )

Flanking Sequence (100 bp) in Reference Genome:


CTTCCTTTCTTAAATGTTTCACGCCGTTAACTTTTTAAAACATGTTTGACCGTTCATCTTATTTAAAAACTTTCGTGAAATGTGTAAAACTATATGAAAA[G/A]
TATATTTAACAATATGTATACATAAAAGTATATTTAACAATAAATCAAATGATAGGAAAAAAATTAATAATTACTTAAATTTTTTTGAATAAGACGAACG

Reverse complement sequence

CGTTCGTCTTATTCAAAAAAATTTAAGTAATTATTAATTTTTTTCCTATCATTTGATTTATTGTTAAATATACTTTTATGTATACATATTGTTAAATATA[C/T]
TTTTCATATAGTTTTACACATTTCACGAAAGTTTTTAAATAAGATGAACGGTCAAACATGTTTTAAAAAGTTAACGGCGTGAAACATTTAAGAAAGGAAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.40% 0.60% 1.74% 51.27% NA
All Indica  2759 21.80% 0.00% 1.74% 76.44% NA
All Japonica  1512 88.00% 1.50% 1.59% 8.93% NA
Aus  269 43.90% 0.00% 3.35% 52.79% NA
Indica I  595 32.90% 0.00% 1.68% 65.38% NA
Indica II  465 14.40% 0.00% 3.23% 82.37% NA
Indica III  913 18.20% 0.10% 0.77% 80.94% NA
Indica Intermediate  786 21.90% 0.00% 2.04% 76.08% NA
Temperate Japonica  767 93.10% 1.80% 2.22% 2.87% NA
Tropical Japonica  504 77.80% 1.20% 0.99% 20.04% NA
Japonica Intermediate  241 92.90% 1.20% 0.83% 4.98% NA
VI/Aromatic  96 96.90% 1.00% 1.04% 1.04% NA
Intermediate  90 58.90% 1.10% 0.00% 40.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0517199333 G -> DEL N N silent_mutation Average:59.16; most accessible tissue: Minghui63 root, score: 70.803 N N N N
vg0517199333 G -> A LOC_Os05g29730.1 upstream_gene_variant ; 3731.0bp to feature; MODIFIER silent_mutation Average:59.16; most accessible tissue: Minghui63 root, score: 70.803 N N N N
vg0517199333 G -> A LOC_Os05g29740.1 upstream_gene_variant ; 312.0bp to feature; MODIFIER silent_mutation Average:59.16; most accessible tissue: Minghui63 root, score: 70.803 N N N N
vg0517199333 G -> A LOC_Os05g29750.1 upstream_gene_variant ; 3107.0bp to feature; MODIFIER silent_mutation Average:59.16; most accessible tissue: Minghui63 root, score: 70.803 N N N N
vg0517199333 G -> A LOC_Os05g29735.1 downstream_gene_variant ; 686.0bp to feature; MODIFIER silent_mutation Average:59.16; most accessible tissue: Minghui63 root, score: 70.803 N N N N
vg0517199333 G -> A LOC_Os05g29735-LOC_Os05g29740 intergenic_region ; MODIFIER silent_mutation Average:59.16; most accessible tissue: Minghui63 root, score: 70.803 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0517199333 1.23E-06 1.23E-06 mr1024 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251