\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0516841556:

Variant ID: vg0516841556 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 16841556
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 304. )

Flanking Sequence (100 bp) in Reference Genome:


CATGCACAGCTAATAGGAATAGTTATTTGGCCACTGGCCCCTCACATGCTTGGGTTTCGTGGGCCGTCAGAACAAAGTCATCTCAATCGGGCCTAAATTA[A/G]
CATTGTTATAGATGTACTCGTACATACATAATCGAGGTGTATATACCTATAACCTGTCACCGATGACACTCATCTGTGACGGGCACACTGTTAGATCCGA

Reverse complement sequence

TCGGATCTAACAGTGTGCCCGTCACAGATGAGTGTCATCGGTGACAGGTTATAGGTATATACACCTCGATTATGTATGTACGAGTACATCTATAACAATG[T/C]
TAATTTAGGCCCGATTGAGATGACTTTGTTCTGACGGCCCACGAAACCCAAGCATGTGAGGGGCCAGTGGCCAAATAACTATTCCTATTAGCTGTGCATG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.60% 5.20% 2.22% 0.00% NA
All Indica  2759 88.20% 8.10% 3.70% 0.00% NA
All Japonica  1512 98.90% 1.10% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 68.60% 18.50% 12.94% 0.00% NA
Indica II  465 85.80% 12.70% 1.51% 0.00% NA
Indica III  913 98.50% 1.30% 0.22% 0.00% NA
Indica Intermediate  786 92.50% 5.50% 2.04% 0.00% NA
Temperate Japonica  767 98.20% 1.70% 0.13% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 5.60% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0516841556 A -> G LOC_Os05g28720.1 upstream_gene_variant ; 4349.0bp to feature; MODIFIER silent_mutation Average:61.78; most accessible tissue: Zhenshan97 young leaf, score: 85.001 N N N N
vg0516841556 A -> G LOC_Os05g28690.1 downstream_gene_variant ; 1553.0bp to feature; MODIFIER silent_mutation Average:61.78; most accessible tissue: Zhenshan97 young leaf, score: 85.001 N N N N
vg0516841556 A -> G LOC_Os05g28690-LOC_Os05g28720 intergenic_region ; MODIFIER silent_mutation Average:61.78; most accessible tissue: Zhenshan97 young leaf, score: 85.001 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0516841556 6.16E-07 6.16E-07 mr1171_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516841556 2.52E-06 2.52E-06 mr1171_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516841556 9.32E-06 9.32E-06 mr1192_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516841556 5.98E-06 5.98E-06 mr1284_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516841556 9.08E-06 9.13E-06 mr1311_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516841556 4.98E-06 4.98E-06 mr1311_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516841556 NA 9.71E-06 mr1332_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516841556 NA 1.58E-06 mr1371_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516841556 8.17E-06 8.17E-06 mr1374_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516841556 8.90E-06 3.69E-06 mr1397_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516841556 2.16E-06 6.24E-09 mr1645_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516841556 4.83E-06 1.06E-07 mr1645_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516841556 6.30E-07 7.70E-08 mr1647_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516841556 1.30E-06 3.59E-07 mr1647_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516841556 9.27E-06 4.23E-07 mr1655_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516841556 3.33E-06 3.64E-06 mr1655_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516841556 7.51E-06 1.42E-06 mr1669_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516841556 1.75E-06 1.95E-06 mr1669_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516841556 5.06E-06 NA mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516841556 NA 4.52E-06 mr1851_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251