\
| Variant ID: vg0516784260 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 16784260 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TAGTATAGATTATAGAATATGGATTTGGTTGGATGTTTTTCTTAGACCAATACTTAGGGCTCATTTTGATCAAGAGAGATTAGGCCCAAAAAATTGAATC[A/G]
AAATCCCTGCTCATCCCATGGAATTTGGTTTAGCCTTTTCCTATCCAACCAAGAACAGTTCAACATTCATACACTTGAGTTTCCTAACCAGAAAATACTA
TAGTATTTTCTGGTTAGGAAACTCAAGTGTATGAATGTTGAACTGTTCTTGGTTGGATAGGAAAAGGCTAAACCAAATTCCATGGGATGAGCAGGGATTT[T/C]
GATTCAATTTTTTGGGCCTAATCTCTCTTGATCAAAATGAGCCCTAAGTATTGGTCTAAGAAAAACATCCAACCAAATCCATATTCTATAATCTATACTA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.00% | 4.00% | 1.97% | 0.00% | NA |
| All Indica | 2759 | 90.50% | 6.20% | 3.23% | 0.00% | NA |
| All Japonica | 1512 | 98.90% | 0.80% | 0.26% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 75.10% | 14.30% | 10.59% | 0.00% | NA |
| Indica II | 465 | 87.10% | 11.80% | 1.08% | 0.00% | NA |
| Indica III | 913 | 99.70% | 0.00% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 93.60% | 4.10% | 2.29% | 0.00% | NA |
| Temperate Japonica | 767 | 98.20% | 1.40% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.40% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0516784260 | A -> G | LOC_Os05g28630.1 | intron_variant ; MODIFIER | silent_mutation | Average:58.765; most accessible tissue: Callus, score: 73.567 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0516784260 | 2.88E-06 | 2.88E-06 | mr1171_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516784260 | 3.10E-06 | 9.06E-09 | mr1645_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516784260 | NA | 2.65E-07 | mr1645_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516784260 | 1.36E-06 | 1.73E-07 | mr1647_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516784260 | 5.10E-06 | 1.29E-06 | mr1647_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516784260 | NA | 6.17E-06 | mr1655_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |