RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0516784260:

Variant ID: vg0516784260 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 16784260
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAGTATAGATTATAGAATATGGATTTGGTTGGATGTTTTTCTTAGACCAATACTTAGGGCTCATTTTGATCAAGAGAGATTAGGCCCAAAAAATTGAATC[A/G]
AAATCCCTGCTCATCCCATGGAATTTGGTTTAGCCTTTTCCTATCCAACCAAGAACAGTTCAACATTCATACACTTGAGTTTCCTAACCAGAAAATACTA

Reverse complement sequence

TAGTATTTTCTGGTTAGGAAACTCAAGTGTATGAATGTTGAACTGTTCTTGGTTGGATAGGAAAAGGCTAAACCAAATTCCATGGGATGAGCAGGGATTT[T/C]
GATTCAATTTTTTGGGCCTAATCTCTCTTGATCAAAATGAGCCCTAAGTATTGGTCTAAGAAAAACATCCAACCAAATCCATATTCTATAATCTATACTA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.00%	4.00%	1.97%	0.00%	NA
All Indica	2759	90.50%	6.20%	3.23%	0.00%	NA
All Japonica	1512	98.90%	0.80%	0.26%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	75.10%	14.30%	10.59%	0.00%	NA
Indica II	465	87.10%	11.80%	1.08%	0.00%	NA
Indica III	913	99.70%	0.00%	0.33%	0.00%	NA
Indica Intermediate	786	93.60%	4.10%	2.29%	0.00%	NA
Temperate Japonica	767	98.20%	1.40%	0.39%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.40%	0.41%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	92.20%	7.80%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0516784260	A -> G	LOC_Os05g28630.1	intron_variant ; MODIFIER	silent_mutation	Average:58.765; most accessible tissue: Callus, score: 73.567	N	N	N	N

Showing 1 to 1 of 1 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0516784260	2.88E-06	2.88E-06	mr1171_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516784260	3.10E-06	9.06E-09	mr1645_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516784260	NA	2.65E-07	mr1645_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516784260	1.36E-06	1.73E-07	mr1647_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516784260	5.10E-06	1.29E-06	mr1647_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516784260	NA	6.17E-06	mr1655_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 6 of 6 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0516784260:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact