\
| Variant ID: vg0516758193 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 16758193 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
AGCAAGGTGGATGTTTGTTTGTCCTTGTCAGCAAACAGAAGGGGGCAAAAGGCGGCCAAAGTGCAACAATATTCTAAACATGGTGCAAACCATAGACTTT[T/C]
CTTAAACATGGTGCAAGCTGCAAGAAGCACCCTAAGTCCTGGTTCAAACTGTAATTCTTGCTCTTCTTTTATTTGTCAAGTGCAGTCTGGAAAGCAGTGC
GCACTGCTTTCCAGACTGCACTTGACAAATAAAAGAAGAGCAAGAATTACAGTTTGAACCAGGACTTAGGGTGCTTCTTGCAGCTTGCACCATGTTTAAG[A/G]
AAAGTCTATGGTTTGCACCATGTTTAGAATATTGTTGCACTTTGGCCGCCTTTTGCCCCCTTCTGTTTGCTGACAAGGACAAACAAACATCCACCTTGCT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.40% | 3.20% | 0.40% | 0.00% | NA |
| All Indica | 2759 | 95.90% | 3.70% | 0.36% | 0.00% | NA |
| All Japonica | 1512 | 96.40% | 3.10% | 0.53% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 78.70% | 19.40% | 1.94% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.30% | 1.50% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.20% | 0.50% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 91.70% | 7.10% | 1.19% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.10% | 2.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 3.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0516758193 | T -> C | LOC_Os05g28610-LOC_Os05g28630 | intergenic_region ; MODIFIER | silent_mutation | Average:58.034; most accessible tissue: Callus, score: 79.272 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0516758193 | NA | 2.56E-09 | mr1039 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516758193 | NA | 9.15E-09 | mr1044 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516758193 | NA | 3.95E-06 | mr1069 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516758193 | NA | 7.47E-06 | mr1077 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516758193 | NA | 3.68E-06 | mr1082 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516758193 | NA | 2.55E-06 | mr1103 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516758193 | NA | 2.62E-08 | mr1482 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516758193 | NA | 1.21E-06 | mr1632 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516758193 | NA | 1.54E-07 | mr1726 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516758193 | NA | 1.62E-09 | mr1039_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |