\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0516694037:

Variant ID: vg0516694037 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 16694037
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.06, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


TGATTCCTTCTGTATTACCAAAAGTGAACGATCTTAAAAACCGACTCAAATACGGATATGTATTTCCAAAAGCAAACGAACTTAAAAACTGACTCATACA[C/T]
GGATGACATACCAAAATACCAGCAAAAACATCTTCAATTTTTATAATAGTAGAGATAGAGAAGAGATATAGATTAAAACCAAAACATAAAATTAAAACCG

Reverse complement sequence

CGGTTTTAATTTTATGTTTTGGTTTTAATCTATATCTCTTCTCTATCTCTACTATTATAAAAATTGAAGATGTTTTTGCTGGTATTTTGGTATGTCATCC[G/A]
TGTATGAGTCAGTTTTTAAGTTCGTTTGCTTTTGGAAATACATATCCGTATTTGAGTCGGTTTTTAAGATCGTTCACTTTTGGTAATACAGAAGGAATCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.70% 37.10% 0.30% 0.00% NA
All Indica  2759 37.80% 61.70% 0.43% 0.00% NA
All Japonica  1512 98.70% 1.30% 0.00% 0.00% NA
Aus  269 97.80% 1.90% 0.37% 0.00% NA
Indica I  595 22.90% 76.80% 0.34% 0.00% NA
Indica II  465 60.00% 40.00% 0.00% 0.00% NA
Indica III  913 38.60% 61.20% 0.22% 0.00% NA
Indica Intermediate  786 35.20% 63.70% 1.02% 0.00% NA
Temperate Japonica  767 98.00% 2.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 73.30% 25.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0516694037 C -> T LOC_Os05g28510.1 upstream_gene_variant ; 2753.0bp to feature; MODIFIER silent_mutation Average:36.78; most accessible tissue: Zhenshan97 root, score: 50.453 N N N N
vg0516694037 C -> T LOC_Os05g28510.2 upstream_gene_variant ; 2753.0bp to feature; MODIFIER silent_mutation Average:36.78; most accessible tissue: Zhenshan97 root, score: 50.453 N N N N
vg0516694037 C -> T LOC_Os05g28510.3 upstream_gene_variant ; 2753.0bp to feature; MODIFIER silent_mutation Average:36.78; most accessible tissue: Zhenshan97 root, score: 50.453 N N N N
vg0516694037 C -> T LOC_Os05g28510.4 upstream_gene_variant ; 2753.0bp to feature; MODIFIER silent_mutation Average:36.78; most accessible tissue: Zhenshan97 root, score: 50.453 N N N N
vg0516694037 C -> T LOC_Os05g28500.1 downstream_gene_variant ; 2955.0bp to feature; MODIFIER silent_mutation Average:36.78; most accessible tissue: Zhenshan97 root, score: 50.453 N N N N
vg0516694037 C -> T LOC_Os05g28500-LOC_Os05g28510 intergenic_region ; MODIFIER silent_mutation Average:36.78; most accessible tissue: Zhenshan97 root, score: 50.453 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0516694037 NA 1.60E-06 mr1360_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516694037 NA 7.55E-06 mr1499_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516694037 NA 2.34E-06 mr1499_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516694037 NA 8.60E-06 mr1647_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516694037 NA 7.83E-06 mr1647_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516694037 NA 5.03E-07 mr1648_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516694037 NA 5.53E-06 mr1648_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516694037 NA 5.08E-08 mr1655_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516694037 9.63E-06 NA mr1861_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516694037 NA 5.50E-08 mr1861_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251