\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0516684304:

Variant ID: vg0516684304 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 16684304
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.67, T: 0.35, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


TGAGGGTAGAGGCCGGTGATGATGAAGATGGCTGCGGCGGCGCCGTTAATTAGCATGGGCTGCACCTCGATCGAGCCGAGGATCCCTCACACCAACCCCG[T/C]
GTTCTTCCTGCTCTCGGGCGGCACGAAGCCGGCGGCTAGATCTCGATGAAACGAATCAGTGATGGCGCTAGGGCAAGGCAGGGTGGCGCGGCACGACGGT

Reverse complement sequence

ACCGTCGTGCCGCGCCACCCTGCCTTGCCCTAGCGCCATCACTGATTCGTTTCATCGAGATCTAGCCGCCGGCTTCGTGCCGCCCGAGAGCAGGAAGAAC[A/G]
CGGGGTTGGTGTGAGGGATCCTCGGCTCGATCGAGGTGCAGCCCATGCTAATTAACGGCGCCGCCGCAGCCATCTTCATCATCACCGGCCTCTACCCTCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.00% 41.60% 0.04% 0.32% NA
All Indica  2759 31.90% 68.10% 0.07% 0.00% NA
All Japonica  1512 98.30% 1.70% 0.00% 0.00% NA
Aus  269 87.00% 13.00% 0.00% 0.00% NA
Indica I  595 25.50% 74.50% 0.00% 0.00% NA
Indica II  465 63.00% 37.00% 0.00% 0.00% NA
Indica III  913 24.60% 75.40% 0.00% 0.00% NA
Indica Intermediate  786 26.60% 73.20% 0.25% 0.00% NA
Temperate Japonica  767 97.50% 2.50% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.80% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 85.40% 0.00% 0.00% 14.58% NA
Intermediate  90 66.70% 32.20% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0516684304 T -> DEL N N silent_mutation Average:64.753; most accessible tissue: Zhenshan97 root, score: 76.035 N N N N
vg0516684304 T -> C LOC_Os05g28500.1 upstream_gene_variant ; 2744.0bp to feature; MODIFIER silent_mutation Average:64.753; most accessible tissue: Zhenshan97 root, score: 76.035 N N N N
vg0516684304 T -> C LOC_Os05g28490.1 downstream_gene_variant ; 2931.0bp to feature; MODIFIER silent_mutation Average:64.753; most accessible tissue: Zhenshan97 root, score: 76.035 N N N N
vg0516684304 T -> C LOC_Os05g28490-LOC_Os05g28500 intergenic_region ; MODIFIER silent_mutation Average:64.753; most accessible tissue: Zhenshan97 root, score: 76.035 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0516684304 NA 2.63E-07 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516684304 NA 9.14E-07 mr1066 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516684304 NA 4.28E-06 mr1066 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516684304 NA 8.96E-07 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516684304 NA 1.93E-07 mr1782 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516684304 NA 1.21E-08 mr1860 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516684304 NA 8.00E-07 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516684304 NA 6.83E-06 mr1186_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516684304 NA 8.68E-06 mr1269_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516684304 NA 1.01E-13 mr1349_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516684304 NA 5.29E-08 mr1349_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516684304 NA 1.63E-06 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516684304 NA 1.13E-09 mr1478_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516684304 NA 2.70E-07 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516684304 NA 3.95E-06 mr1576_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516684304 NA 1.84E-10 mr1627_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516684304 NA 3.85E-08 mr1655_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516684304 NA 2.41E-06 mr1655_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516684304 NA 1.46E-06 mr1677_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516684304 NA 6.60E-07 mr1875_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516684304 NA 5.92E-07 mr1895_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516684304 NA 3.44E-06 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516684304 NA 1.29E-06 mr1910_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516684304 NA 7.95E-06 mr1977_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251