Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0516673461:

Variant ID: vg0516673461 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 16673461
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:

ATAAATATTAAACGTAGACTATTAATAAAACCCATCCATAATCTTGGACTAATTCGCGAGACGAATCTATTGAGCATAATTAATCCATGATTAGCCTATG[C/T]
GATGCTACAGTAAACATTCTCTAATTATGGATTAATTAGGCTTAAAAAATTTGTCTTGCAAATTAGCTTTCATTTATGTAATTAGTTTTGTAAGTAGTCT

Reverse complement sequence

AGACTACTTACAAAACTAATTACATAAATGAAAGCTAATTTGCAAGACAAATTTTTTAAGCCTAATTAATCCATAATTAGAGAATGTTTACTGTAGCATC[G/A]
CATAGGCTAATCATGGATTAATTATGCTCAATAGATTCGTCTCGCGAATTAGTCCAAGATTATGGATGGGTTTTATTAATAGTCTACGTTTAATATTTAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.90%	29.90%	0.23%	0.00%	NA
All Indica	2759	49.90%	49.70%	0.36%	0.00%	NA
All Japonica	1512	98.70%	1.30%	0.00%	0.00%	NA
Aus	269	98.10%	1.90%	0.00%	0.00%	NA
Indica I	595	43.90%	56.00%	0.17%	0.00%	NA
Indica II	465	72.90%	26.70%	0.43%	0.00%	NA
Indica III	913	45.20%	54.50%	0.22%	0.00%	NA
Indica Intermediate	786	46.40%	52.90%	0.64%	0.00%	NA
Temperate Japonica	767	98.00%	2.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	80.00%	18.90%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0516673461	C -> T	LOC_Os05g28470.1	downstream_gene_variant ; 2110.0bp to feature; MODIFIER	silent_mutation	Average:63.635; most accessible tissue: Minghui63 panicle, score: 82.128	N	N	N	N
vg0516673461	C -> T	LOC_Os05g28480.1	intron_variant ; MODIFIER	silent_mutation	Average:63.635; most accessible tissue: Minghui63 panicle, score: 82.128	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0516673461	NA	9.76E-09	mr1860	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516673461	NA	1.98E-06	mr1158_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516673461	NA	3.67E-06	mr1158_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516673461	NA	1.12E-06	mr1332_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516673461	NA	2.03E-11	mr1349_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516673461	NA	4.89E-07	mr1355_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516673461	NA	2.28E-07	mr1360_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516673461	NA	6.00E-06	mr1371_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516673461	NA	3.10E-06	mr1499_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516673461	NA	1.48E-06	mr1499_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516673461	NA	6.48E-08	mr1645_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516673461	NA	2.15E-06	mr1645_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516673461	NA	2.53E-06	mr1647_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516673461	NA	4.07E-06	mr1647_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516673461	NA	1.79E-07	mr1648_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516673461	NA	7.55E-07	mr1648_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516673461	NA	5.83E-10	mr1655_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516673461	6.61E-06	1.48E-07	mr1655_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516673461	NA	3.43E-06	mr1657_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516673461	NA	1.06E-07	mr1669_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516673461	NA	2.08E-07	mr1669_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516673461	NA	8.62E-06	mr1682_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251