\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0516657915:

Variant ID: vg0516657915 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 16657915
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


ATACCTAAGAAAAGATAATTTAGGATTTTCAAATTTTAAGGAAATTGTACTAATTCCATAAACATTTGCAAAATTTCTGCTTCTTAATAACACACTGAAA[C/T]
AATTTGCACAGGTGTTCTCCTAAGGCACGCTGATTTTCTAGCCTTTATTTTTAATGCTGACGGTGTCGGCCAACGTGTCATCAGGCTCTTGGCAAATAAA

Reverse complement sequence

TTTATTTGCCAAGAGCCTGATGACACGTTGGCCGACACCGTCAGCATTAAAAATAAAGGCTAGAAAATCAGCGTGCCTTAGGAGAACACCTGTGCAAATT[G/A]
TTTCAGTGTGTTATTAAGAAGCAGAAATTTTGCAAATGTTTATGGAATTAGTACAATTTCCTTAAAATTTGAAAATCCTAAATTATCTTTTCTTAGGTAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.10% 35.80% 0.06% 0.00% NA
All Indica  2759 41.70% 58.20% 0.11% 0.00% NA
All Japonica  1512 98.30% 1.70% 0.00% 0.00% NA
Aus  269 85.90% 14.10% 0.00% 0.00% NA
Indica I  595 41.20% 58.80% 0.00% 0.00% NA
Indica II  465 65.60% 34.20% 0.22% 0.00% NA
Indica III  913 31.00% 69.00% 0.00% 0.00% NA
Indica Intermediate  786 40.30% 59.40% 0.25% 0.00% NA
Temperate Japonica  767 97.50% 2.50% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.80% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 74.40% 25.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0516657915 C -> T LOC_Os05g28450.1 upstream_gene_variant ; 1366.0bp to feature; MODIFIER silent_mutation Average:53.567; most accessible tissue: Zhenshan97 young leaf, score: 65.28 N N N N
vg0516657915 C -> T LOC_Os05g28460.1 upstream_gene_variant ; 4754.0bp to feature; MODIFIER silent_mutation Average:53.567; most accessible tissue: Zhenshan97 young leaf, score: 65.28 N N N N
vg0516657915 C -> T LOC_Os05g28440-LOC_Os05g28450 intergenic_region ; MODIFIER silent_mutation Average:53.567; most accessible tissue: Zhenshan97 young leaf, score: 65.28 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0516657915 NA 4.21E-13 mr1349_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516657915 NA 1.82E-08 mr1349_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516657915 NA 8.96E-08 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516657915 NA 5.75E-06 mr1355_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516657915 NA 1.64E-07 mr1655_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516657915 NA 9.55E-06 mr1655_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516657915 NA 1.68E-07 mr1895_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516657915 NA 1.27E-06 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251