Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0516657915:

Variant ID: vg0516657915 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 16657915
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

ATACCTAAGAAAAGATAATTTAGGATTTTCAAATTTTAAGGAAATTGTACTAATTCCATAAACATTTGCAAAATTTCTGCTTCTTAATAACACACTGAAA[C/T]
AATTTGCACAGGTGTTCTCCTAAGGCACGCTGATTTTCTAGCCTTTATTTTTAATGCTGACGGTGTCGGCCAACGTGTCATCAGGCTCTTGGCAAATAAA

Reverse complement sequence

TTTATTTGCCAAGAGCCTGATGACACGTTGGCCGACACCGTCAGCATTAAAAATAAAGGCTAGAAAATCAGCGTGCCTTAGGAGAACACCTGTGCAAATT[G/A]
TTTCAGTGTGTTATTAAGAAGCAGAAATTTTGCAAATGTTTATGGAATTAGTACAATTTCCTTAAAATTTGAAAATCCTAAATTATCTTTTCTTAGGTAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.10%	35.80%	0.06%	0.00%	NA
All Indica	2759	41.70%	58.20%	0.11%	0.00%	NA
All Japonica	1512	98.30%	1.70%	0.00%	0.00%	NA
Aus	269	85.90%	14.10%	0.00%	0.00%	NA
Indica I	595	41.20%	58.80%	0.00%	0.00%	NA
Indica II	465	65.60%	34.20%	0.22%	0.00%	NA
Indica III	913	31.00%	69.00%	0.00%	0.00%	NA
Indica Intermediate	786	40.30%	59.40%	0.25%	0.00%	NA
Temperate Japonica	767	97.50%	2.50%	0.00%	0.00%	NA
Tropical Japonica	504	99.20%	0.80%	0.00%	0.00%	NA
Japonica Intermediate	241	98.80%	1.20%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	74.40%	25.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0516657915	C -> T	LOC_Os05g28450.1	upstream_gene_variant ; 1366.0bp to feature; MODIFIER	silent_mutation	Average:53.567; most accessible tissue: Zhenshan97 young leaf, score: 65.28	N	N	N	N
vg0516657915	C -> T	LOC_Os05g28460.1	upstream_gene_variant ; 4754.0bp to feature; MODIFIER	silent_mutation	Average:53.567; most accessible tissue: Zhenshan97 young leaf, score: 65.28	N	N	N	N
vg0516657915	C -> T	LOC_Os05g28440-LOC_Os05g28450	intergenic_region ; MODIFIER	silent_mutation	Average:53.567; most accessible tissue: Zhenshan97 young leaf, score: 65.28	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0516657915	NA	4.21E-13	mr1349_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516657915	NA	1.82E-08	mr1349_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516657915	NA	8.96E-08	mr1355_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516657915	NA	5.75E-06	mr1355_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516657915	NA	1.64E-07	mr1655_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516657915	NA	9.55E-06	mr1655_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516657915	NA	1.68E-07	mr1895_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516657915	NA	1.27E-06	mr1895_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251