\
| Variant ID: vg0516657915 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 16657915 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 236. )
ATACCTAAGAAAAGATAATTTAGGATTTTCAAATTTTAAGGAAATTGTACTAATTCCATAAACATTTGCAAAATTTCTGCTTCTTAATAACACACTGAAA[C/T]
AATTTGCACAGGTGTTCTCCTAAGGCACGCTGATTTTCTAGCCTTTATTTTTAATGCTGACGGTGTCGGCCAACGTGTCATCAGGCTCTTGGCAAATAAA
TTTATTTGCCAAGAGCCTGATGACACGTTGGCCGACACCGTCAGCATTAAAAATAAAGGCTAGAAAATCAGCGTGCCTTAGGAGAACACCTGTGCAAATT[G/A]
TTTCAGTGTGTTATTAAGAAGCAGAAATTTTGCAAATGTTTATGGAATTAGTACAATTTCCTTAAAATTTGAAAATCCTAAATTATCTTTTCTTAGGTAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.10% | 35.80% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 41.70% | 58.20% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 85.90% | 14.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 41.20% | 58.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 65.60% | 34.20% | 0.22% | 0.00% | NA |
| Indica III | 913 | 31.00% | 69.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 40.30% | 59.40% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 74.40% | 25.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0516657915 | C -> T | LOC_Os05g28450.1 | upstream_gene_variant ; 1366.0bp to feature; MODIFIER | silent_mutation | Average:53.567; most accessible tissue: Zhenshan97 young leaf, score: 65.28 | N | N | N | N |
| vg0516657915 | C -> T | LOC_Os05g28460.1 | upstream_gene_variant ; 4754.0bp to feature; MODIFIER | silent_mutation | Average:53.567; most accessible tissue: Zhenshan97 young leaf, score: 65.28 | N | N | N | N |
| vg0516657915 | C -> T | LOC_Os05g28440-LOC_Os05g28450 | intergenic_region ; MODIFIER | silent_mutation | Average:53.567; most accessible tissue: Zhenshan97 young leaf, score: 65.28 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0516657915 | NA | 4.21E-13 | mr1349_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516657915 | NA | 1.82E-08 | mr1349_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516657915 | NA | 8.96E-08 | mr1355_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516657915 | NA | 5.75E-06 | mr1355_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516657915 | NA | 1.64E-07 | mr1655_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516657915 | NA | 9.55E-06 | mr1655_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516657915 | NA | 1.68E-07 | mr1895_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516657915 | NA | 1.27E-06 | mr1895_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |