\
| Variant ID: vg0516647020 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 16647020 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AGTGCATGGAGCGCAACTCAGGGGTGACTGTGCAAAAGTTCAAGTCGACTCGATGAAGCCGGAATATGAGCTATTCCCACTAAAGTATCCACCGAATGAC[G/A]
AGGTCCTCTCACTAGGAAATGCCCGTGGTACCTTCATCCAATGGCCCAAAGACCTCATTGAGATCAAGATTACAGCGAGGCCAACCACTGCACCAGGCGG
CCGCCTGGTGCAGTGGTTGGCCTCGCTGTAATCTTGATCTCAATGAGGTCTTTGGGCCATTGGATGAAGGTACCACGGGCATTTCCTAGTGAGAGGACCT[C/T]
GTCATTCGGTGGATACTTTAGTGGGAATAGCTCATATTCCGGCTTCATCGAGTCGACTTGAACTTTTGCACAGTCACCCCTGAGTTGCGCTCCATGCACT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.60% | 28.40% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 52.70% | 47.20% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 45.00% | 55.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 73.50% | 26.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 46.90% | 53.00% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 52.90% | 46.70% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 17.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0516647020 | G -> A | LOC_Os05g28430.1 | missense_variant ; p.Glu400Lys; MODERATE | nonsynonymous_codon ; E400K | Average:35.352; most accessible tissue: Zhenshan97 flag leaf, score: 68.703 | benign |
0.278 |
DELETERIOUS | 0.03 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0516647020 | 4.35E-06 | 4.35E-06 | mr1273_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516647020 | NA | 6.61E-06 | mr1355_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516647020 | NA | 9.52E-06 | mr1360_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516647020 | NA | 3.01E-07 | mr1499_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516647020 | NA | 5.61E-07 | mr1499_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516647020 | NA | 6.18E-06 | mr1645_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516647020 | NA | 4.24E-06 | mr1647_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516647020 | NA | 5.89E-06 | mr1648_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516647020 | NA | 2.29E-08 | mr1655_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516647020 | NA | 3.56E-06 | mr1655_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516647020 | NA | 1.45E-06 | mr1669_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516647020 | NA | 4.06E-06 | mr1669_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |