RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0516563624:

Variant ID: vg0516563624 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 16563624
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 331. )

Flanking Sequence (100 bp) in Reference Genome:

CAATACATAAGAGCAAAGAATAGAAAACTAAGCTTTGATCTTCTACTGCATGATGAGCCCTGTCACACCAAGAACCGCACTGGATCGATCTTGAAACGCA[G/A]
CCCTAACATGCATTCTTCATCCATGATCCATTCACGGATTCACCTCTAACTTGCTCTTACTCAACTTTGCCCATATCATCATATAGATCCATTCGATTCA

Reverse complement sequence

TGAATCGAATGGATCTATATGATGATATGGGCAAAGTTGAGTAAGAGCAAGTTAGAGGTGAATCCGTGAATGGATCATGGATGAAGAATGCATGTTAGGG[C/T]
TGCGTTTCAAGATCGATCCAGTGCGGTTCTTGGTGTGACAGGGCTCATCATGCAGTAGAAGATCAAAGCTTAGTTTTCTATTCTTTGCTCTTATGTATTG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.60%	5.30%	2.16%	0.00%	NA
All Indica	2759	88.10%	8.30%	3.59%	0.00%	NA
All Japonica	1512	98.90%	1.00%	0.07%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	67.20%	21.30%	11.43%	0.00%	NA
Indica II	465	86.70%	10.30%	3.01%	0.00%	NA
Indica III	913	98.70%	1.20%	0.11%	0.00%	NA
Indica Intermediate	786	92.50%	5.50%	2.04%	0.00%	NA
Temperate Japonica	767	98.30%	1.60%	0.13%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	92.20%	5.60%	2.22%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0516563624	G -> A	LOC_Os05g28300.1	upstream_gene_variant ; 2917.0bp to feature; MODIFIER	silent_mutation	Average:73.479; most accessible tissue: Zhenshan97 young leaf, score: 83.623	N	N	N	N
vg0516563624	G -> A	LOC_Os05g28290.1	downstream_gene_variant ; 1094.0bp to feature; MODIFIER	silent_mutation	Average:73.479; most accessible tissue: Zhenshan97 young leaf, score: 83.623	N	N	N	N
vg0516563624	G -> A	LOC_Os05g28290-LOC_Os05g28300	intergenic_region ; MODIFIER	silent_mutation	Average:73.479; most accessible tissue: Zhenshan97 young leaf, score: 83.623	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0516563624	NA	2.59E-06	mr1170_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516563624	1.05E-07	1.05E-07	mr1171_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516563624	4.90E-07	4.90E-07	mr1171_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516563624	NA	4.65E-06	mr1184_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516563624	3.41E-06	9.32E-06	mr1245_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516563624	NA	3.07E-06	mr1278_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516563624	5.29E-06	5.29E-06	mr1284_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516563624	6.63E-06	NA	mr1329_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516563624	6.09E-06	6.09E-06	mr1329_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516563624	NA	4.79E-06	mr1371_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 29 entries

Previous1 2 3Next

Search for Variation information by Variation ID:

Detailed information for vg0516563624:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact