\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0516439203:

Variant ID: vg0516439203 (JBrowse)Variation Type: INDEL
Chromosome: chr05Position: 16439203
Reference Allele: ATAlternative Allele: ATT,ATTT,A,TT
Primary Allele: ATTSecondary Allele: AT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTATCTATAAACTTGACATAGCCTATATCTAACTTTATAGCTAAAAATGGCCTTTTTTTAGTACGAAGTTGTAGTTGAGTTTTAAACATTATACATTTA[AT/ATT,ATTT,A,TT]
TTTTTTTTGTCTTTTTAGAGGTTGTACGACGATGTAGTTGACTTTTAAACATTATATGTTGAATTTTAAGAGTATAAATCTGACATATTTTTATTTTTTT

Reverse complement sequence

AAAAAAATAAAAATATGTCAGATTTATACTCTTAAAATTCAACATATAATGTTTAAAAGTCAACTACATCGTCGTACAACCTCTAAAAAGACAAAAAAAA[AT/AAT,AAAT,T,AA]
TAAATGTATAATGTTTAAAACTCAACTACAACTTCGTACTAAAAAAAGGCCATTTTTAGCTATAAAGTTAGATATAGGCTATGTCAAGTTTATAGATAAA

Allele Frequencies:

Populations Population SizeFrequency of ATT(primary allele) Frequency of AT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.00% 19.30% 0.85% 21.92% TT: 6.81%; A: 3.96%; ATTT: 0.19%
All Indica  2759 63.90% 3.60% 1.34% 13.08% TT: 11.24%; A: 6.67%; ATTT: 0.25%
All Japonica  1512 24.10% 49.70% 0.13% 25.53% TT: 0.46%; A: 0.07%; ATTT: 0.07%
Aus  269 20.40% 12.60% 0.37% 65.80% TT: 0.37%; ATTT: 0.37%
Indica I  595 74.30% 3.20% 1.68% 3.19% A: 10.92%; TT: 6.72%
Indica II  465 51.60% 2.80% 0.43% 24.95% TT: 18.49%; A: 1.72%
Indica III  913 65.40% 4.10% 0.66% 15.77% A: 7.34%; TT: 6.02%; ATTT: 0.77%
Indica Intermediate  786 61.50% 3.70% 2.42% 10.43% TT: 16.41%; A: 5.60%
Temperate Japonica  767 6.90% 85.10% 0.00% 7.69% TT: 0.26%
Tropical Japonica  504 51.60% 6.90% 0.40% 40.28% TT: 0.60%; A: 0.20%
Japonica Intermediate  241 21.20% 26.10% 0.00% 51.45% TT: 0.83%; ATTT: 0.41%
VI/Aromatic  96 6.20% 1.00% 0.00% 92.71% NA
Intermediate  90 38.90% 28.90% 0.00% 25.56% TT: 4.44%; A: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0516439203 AT -> DEL N N silent_mutation Average:37.959; most accessible tissue: Callus, score: 89.176 N N N N
vg0516439203 AT -> ATTT LOC_Os05g28120.1 downstream_gene_variant ; 4335.0bp to feature; MODIFIER silent_mutation Average:37.959; most accessible tissue: Callus, score: 89.176 N N N N
vg0516439203 AT -> ATTT LOC_Os05g28100-LOC_Os05g28120 intergenic_region ; MODIFIER silent_mutation Average:37.959; most accessible tissue: Callus, score: 89.176 N N N N
vg0516439203 AT -> TT LOC_Os05g28120.1 downstream_gene_variant ; 4337.0bp to feature; MODIFIER silent_mutation Average:37.959; most accessible tissue: Callus, score: 89.176 N N N N
vg0516439203 AT -> TT LOC_Os05g28100-LOC_Os05g28120 intergenic_region ; MODIFIER silent_mutation Average:37.959; most accessible tissue: Callus, score: 89.176 N N N N
vg0516439203 AT -> ATT LOC_Os05g28120.1 downstream_gene_variant ; 4335.0bp to feature; MODIFIER silent_mutation Average:37.959; most accessible tissue: Callus, score: 89.176 N N N N
vg0516439203 AT -> ATT LOC_Os05g28100-LOC_Os05g28120 intergenic_region ; MODIFIER silent_mutation Average:37.959; most accessible tissue: Callus, score: 89.176 N N N N
vg0516439203 AT -> A LOC_Os05g28120.1 downstream_gene_variant ; 4336.0bp to feature; MODIFIER silent_mutation Average:37.959; most accessible tissue: Callus, score: 89.176 N N N N
vg0516439203 AT -> A LOC_Os05g28100-LOC_Os05g28120 intergenic_region ; MODIFIER silent_mutation Average:37.959; most accessible tissue: Callus, score: 89.176 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0516439203 4.24E-06 NA mr1024_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251