\
| Variant ID: vg0516439203 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr05 | Position: 16439203 |
| Reference Allele: AT | Alternative Allele: ATT,ATTT,A,TT |
| Primary Allele: ATT | Secondary Allele: AT |
Inferred Ancestral Allele: Not determined.
TTTATCTATAAACTTGACATAGCCTATATCTAACTTTATAGCTAAAAATGGCCTTTTTTTAGTACGAAGTTGTAGTTGAGTTTTAAACATTATACATTTA[AT/ATT,ATTT,A,TT]
TTTTTTTTGTCTTTTTAGAGGTTGTACGACGATGTAGTTGACTTTTAAACATTATATGTTGAATTTTAAGAGTATAAATCTGACATATTTTTATTTTTTT
AAAAAAATAAAAATATGTCAGATTTATACTCTTAAAATTCAACATATAATGTTTAAAAGTCAACTACATCGTCGTACAACCTCTAAAAAGACAAAAAAAA[AT/AAT,AAAT,T,AA]
TAAATGTATAATGTTTAAAACTCAACTACAACTTCGTACTAAAAAAAGGCCATTTTTAGCTATAAAGTTAGATATAGGCTATGTCAAGTTTATAGATAAA
| Populations | Population Size | Frequency of ATT(primary allele) | Frequency of AT(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 47.00% | 19.30% | 0.85% | 21.92% | TT: 6.81%; A: 3.96%; ATTT: 0.19% |
| All Indica | 2759 | 63.90% | 3.60% | 1.34% | 13.08% | TT: 11.24%; A: 6.67%; ATTT: 0.25% |
| All Japonica | 1512 | 24.10% | 49.70% | 0.13% | 25.53% | TT: 0.46%; A: 0.07%; ATTT: 0.07% |
| Aus | 269 | 20.40% | 12.60% | 0.37% | 65.80% | TT: 0.37%; ATTT: 0.37% |
| Indica I | 595 | 74.30% | 3.20% | 1.68% | 3.19% | A: 10.92%; TT: 6.72% |
| Indica II | 465 | 51.60% | 2.80% | 0.43% | 24.95% | TT: 18.49%; A: 1.72% |
| Indica III | 913 | 65.40% | 4.10% | 0.66% | 15.77% | A: 7.34%; TT: 6.02%; ATTT: 0.77% |
| Indica Intermediate | 786 | 61.50% | 3.70% | 2.42% | 10.43% | TT: 16.41%; A: 5.60% |
| Temperate Japonica | 767 | 6.90% | 85.10% | 0.00% | 7.69% | TT: 0.26% |
| Tropical Japonica | 504 | 51.60% | 6.90% | 0.40% | 40.28% | TT: 0.60%; A: 0.20% |
| Japonica Intermediate | 241 | 21.20% | 26.10% | 0.00% | 51.45% | TT: 0.83%; ATTT: 0.41% |
| VI/Aromatic | 96 | 6.20% | 1.00% | 0.00% | 92.71% | NA |
| Intermediate | 90 | 38.90% | 28.90% | 0.00% | 25.56% | TT: 4.44%; A: 2.22% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0516439203 | AT -> DEL | N | N | silent_mutation | Average:37.959; most accessible tissue: Callus, score: 89.176 | N | N | N | N |
| vg0516439203 | AT -> ATTT | LOC_Os05g28120.1 | downstream_gene_variant ; 4335.0bp to feature; MODIFIER | silent_mutation | Average:37.959; most accessible tissue: Callus, score: 89.176 | N | N | N | N |
| vg0516439203 | AT -> ATTT | LOC_Os05g28100-LOC_Os05g28120 | intergenic_region ; MODIFIER | silent_mutation | Average:37.959; most accessible tissue: Callus, score: 89.176 | N | N | N | N |
| vg0516439203 | AT -> TT | LOC_Os05g28120.1 | downstream_gene_variant ; 4337.0bp to feature; MODIFIER | silent_mutation | Average:37.959; most accessible tissue: Callus, score: 89.176 | N | N | N | N |
| vg0516439203 | AT -> TT | LOC_Os05g28100-LOC_Os05g28120 | intergenic_region ; MODIFIER | silent_mutation | Average:37.959; most accessible tissue: Callus, score: 89.176 | N | N | N | N |
| vg0516439203 | AT -> ATT | LOC_Os05g28120.1 | downstream_gene_variant ; 4335.0bp to feature; MODIFIER | silent_mutation | Average:37.959; most accessible tissue: Callus, score: 89.176 | N | N | N | N |
| vg0516439203 | AT -> ATT | LOC_Os05g28100-LOC_Os05g28120 | intergenic_region ; MODIFIER | silent_mutation | Average:37.959; most accessible tissue: Callus, score: 89.176 | N | N | N | N |
| vg0516439203 | AT -> A | LOC_Os05g28120.1 | downstream_gene_variant ; 4336.0bp to feature; MODIFIER | silent_mutation | Average:37.959; most accessible tissue: Callus, score: 89.176 | N | N | N | N |
| vg0516439203 | AT -> A | LOC_Os05g28100-LOC_Os05g28120 | intergenic_region ; MODIFIER | silent_mutation | Average:37.959; most accessible tissue: Callus, score: 89.176 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0516439203 | 4.24E-06 | NA | mr1024_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |