Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0516439203:

Variant ID: vg0516439203 (JBrowse)	Variation Type: INDEL
Chromosome: chr05	Position: 16439203
Reference Allele: AT	Alternative Allele: ATT,ATTT,A,TT
Primary Allele: ATT	Secondary Allele: AT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTATCTATAAACTTGACATAGCCTATATCTAACTTTATAGCTAAAAATGGCCTTTTTTTAGTACGAAGTTGTAGTTGAGTTTTAAACATTATACATTTA[AT/ATT,ATTT,A,TT]
TTTTTTTTGTCTTTTTAGAGGTTGTACGACGATGTAGTTGACTTTTAAACATTATATGTTGAATTTTAAGAGTATAAATCTGACATATTTTTATTTTTTT

Reverse complement sequence

AAAAAAATAAAAATATGTCAGATTTATACTCTTAAAATTCAACATATAATGTTTAAAAGTCAACTACATCGTCGTACAACCTCTAAAAAGACAAAAAAAA[AT/AAT,AAAT,T,AA]
TAAATGTATAATGTTTAAAACTCAACTACAACTTCGTACTAAAAAAAGGCCATTTTTAGCTATAAAGTTAGATATAGGCTATGTCAAGTTTATAGATAAA

Allele Frequencies:

Populations	Population Size	Frequency of ATT(primary allele)	Frequency of AT(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	47.00%	19.30%	0.85%	21.92%	TT: 6.81%; A: 3.96%; ATTT: 0.19%
All Indica	2759	63.90%	3.60%	1.34%	13.08%	TT: 11.24%; A: 6.67%; ATTT: 0.25%
All Japonica	1512	24.10%	49.70%	0.13%	25.53%	TT: 0.46%; A: 0.07%; ATTT: 0.07%
Aus	269	20.40%	12.60%	0.37%	65.80%	TT: 0.37%; ATTT: 0.37%
Indica I	595	74.30%	3.20%	1.68%	3.19%	A: 10.92%; TT: 6.72%
Indica II	465	51.60%	2.80%	0.43%	24.95%	TT: 18.49%; A: 1.72%
Indica III	913	65.40%	4.10%	0.66%	15.77%	A: 7.34%; TT: 6.02%; ATTT: 0.77%
Indica Intermediate	786	61.50%	3.70%	2.42%	10.43%	TT: 16.41%; A: 5.60%
Temperate Japonica	767	6.90%	85.10%	0.00%	7.69%	TT: 0.26%
Tropical Japonica	504	51.60%	6.90%	0.40%	40.28%	TT: 0.60%; A: 0.20%
Japonica Intermediate	241	21.20%	26.10%	0.00%	51.45%	TT: 0.83%; ATTT: 0.41%
VI/Aromatic	96	6.20%	1.00%	0.00%	92.71%	NA
Intermediate	90	38.90%	28.90%	0.00%	25.56%	TT: 4.44%; A: 2.22%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0516439203	AT -> DEL	N	N	silent_mutation	Average:37.959; most accessible tissue: Callus, score: 89.176	N	N	N	N
vg0516439203	AT -> ATTT	LOC_Os05g28120.1	downstream_gene_variant ; 4335.0bp to feature; MODIFIER	silent_mutation	Average:37.959; most accessible tissue: Callus, score: 89.176	N	N	N	N
vg0516439203	AT -> ATTT	LOC_Os05g28100-LOC_Os05g28120	intergenic_region ; MODIFIER	silent_mutation	Average:37.959; most accessible tissue: Callus, score: 89.176	N	N	N	N
vg0516439203	AT -> TT	LOC_Os05g28120.1	downstream_gene_variant ; 4337.0bp to feature; MODIFIER	silent_mutation	Average:37.959; most accessible tissue: Callus, score: 89.176	N	N	N	N
vg0516439203	AT -> TT	LOC_Os05g28100-LOC_Os05g28120	intergenic_region ; MODIFIER	silent_mutation	Average:37.959; most accessible tissue: Callus, score: 89.176	N	N	N	N
vg0516439203	AT -> ATT	LOC_Os05g28120.1	downstream_gene_variant ; 4335.0bp to feature; MODIFIER	silent_mutation	Average:37.959; most accessible tissue: Callus, score: 89.176	N	N	N	N
vg0516439203	AT -> ATT	LOC_Os05g28100-LOC_Os05g28120	intergenic_region ; MODIFIER	silent_mutation	Average:37.959; most accessible tissue: Callus, score: 89.176	N	N	N	N
vg0516439203	AT -> A	LOC_Os05g28120.1	downstream_gene_variant ; 4336.0bp to feature; MODIFIER	silent_mutation	Average:37.959; most accessible tissue: Callus, score: 89.176	N	N	N	N
vg0516439203	AT -> A	LOC_Os05g28100-LOC_Os05g28120	intergenic_region ; MODIFIER	silent_mutation	Average:37.959; most accessible tissue: Callus, score: 89.176	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0516439203	4.24E-06	NA	mr1024_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251