Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0516426471:

Variant ID: vg0516426471 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 16426471
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.68, C: 0.36, others allele: 0.00, population size: 28. )

Flanking Sequence (100 bp) in Reference Genome:


TCAACTTCAAACAGAAGGCATGAGAGAGAGAAAGAGAGAGAGGTGAAGTAAGCCAAATTAGAGCAAGGTCAATAGGGAGCCCACTACCATCTCCAATTTT[C/T]
TGTCCAGCTCAGGAAGAGCTAGCATATAGCTTATCAAGTACAATAGATTAGTTGTAAAATGTCAGAGATTAATACATTAAACTATTTAATGCATGCATGC

Reverse complement sequence

GCATGCATGCATTAAATAGTTTAATGTATTAATCTCTGACATTTTACAACTAATCTATTGTACTTGATAAGCTATATGCTAGCTCTTCCTGAGCTGGACA[G/A]
AAAATTGGAGATGGTAGTGGGCTCCCTATTGACCTTGCTCTAATTTGGCTTACTTCACCTCTCTCTCTTTCTCTCTCTCATGCCTTCTGTTTGAAGTTGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.00% 17.90% 4.21% 16.84% NA
All Indica  2759 85.80% 1.00% 5.07% 8.12% NA
All Japonica  1512 25.10% 49.30% 0.26% 25.33% NA
Aus  269 33.10% 8.90% 17.47% 40.52% NA
Indica I  595 95.60% 1.20% 1.01% 2.18% NA
Indica II  465 73.10% 1.70% 6.67% 18.49% NA
Indica III  913 84.00% 0.80% 7.34% 7.89% NA
Indica Intermediate  786 87.90% 0.80% 4.58% 6.74% NA
Temperate Japonica  767 7.00% 85.10% 0.13% 7.69% NA
Tropical Japonica  504 54.20% 5.60% 0.00% 40.28% NA
Japonica Intermediate  241 21.60% 27.00% 1.24% 50.21% NA
VI/Aromatic  96 6.20% 20.80% 5.21% 67.71% NA
Intermediate  90 48.90% 31.10% 3.33% 16.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0516426471 C -> T LOC_Os05g28090.1 upstream_gene_variant ; 3250.0bp to feature; MODIFIER silent_mutation Average:74.644; most accessible tissue: Minghui63 flag leaf, score: 91.692 N N N N
vg0516426471 C -> T LOC_Os05g28090.2 upstream_gene_variant ; 3250.0bp to feature; MODIFIER silent_mutation Average:74.644; most accessible tissue: Minghui63 flag leaf, score: 91.692 N N N N
vg0516426471 C -> T LOC_Os05g28090.3 upstream_gene_variant ; 3250.0bp to feature; MODIFIER silent_mutation Average:74.644; most accessible tissue: Minghui63 flag leaf, score: 91.692 N N N N
vg0516426471 C -> T LOC_Os05g28100.1 downstream_gene_variant ; 408.0bp to feature; MODIFIER silent_mutation Average:74.644; most accessible tissue: Minghui63 flag leaf, score: 91.692 N N N N
vg0516426471 C -> T LOC_Os05g28090-LOC_Os05g28100 intergenic_region ; MODIFIER silent_mutation Average:74.644; most accessible tissue: Minghui63 flag leaf, score: 91.692 N N N N
vg0516426471 C -> DEL N N silent_mutation Average:74.644; most accessible tissue: Minghui63 flag leaf, score: 91.692 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0516426471 C T -0.04 -0.02 -0.03 -0.04 -0.06 -0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0516426471 NA 5.58E-14 Grain_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0516426471 NA 1.77E-11 mr1368 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516426471 NA 3.35E-06 mr1639 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516426471 NA 3.96E-12 mr1087_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516426471 NA 8.72E-07 mr1091_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516426471 NA 5.48E-09 mr1235_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516426471 NA 1.44E-07 mr1350_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516426471 NA 1.67E-06 mr1582_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251