Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0516417324:

Variant ID: vg0516417324 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 16417324
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.06, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:


TCAAGTACACCCTCGTCTTCGAAGTTACGAACCACGCGGTACTCCGAAGTGATATAGTATCCGACTTCAGCGGCCAAGGCACGAAGTTCCTCCACAAAAC[T/C]
GACCAAGTTGAAGCAGCGGGTAGTCTCGAACTCAGGCATCTACAACATTTTGAAATAAGAACCAATGACCAGATTTGTAAACAGTGCACAGGTGAAGATA

Reverse complement sequence

TATCTTCACCTGTGCACTGTTTACAAATCTGGTCATTGGTTCTTATTTCAAAATGTTGTAGATGCCTGAGTTCGAGACTACCCGCTGCTTCAACTTGGTC[A/G]
GTTTTGTGGAGGAACTTCGTGCCTTGGCCGCTGAAGTCGGATACTATATCACTTCGGAGTACCGCGTGGTTCGTAACTTCGAAGACGAGGGTGTACTTGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 17.40% 7.40% 0.72% 74.50% NA
All Indica  2759 1.70% 12.20% 0.65% 85.43% NA
All Japonica  1512 49.70% 0.30% 0.60% 49.47% NA
Aus  269 0.00% 0.40% 0.37% 99.26% NA
Indica I  595 3.40% 7.70% 0.34% 88.57% NA
Indica II  465 2.60% 20.20% 1.94% 75.27% NA
Indica III  913 0.30% 6.90% 0.22% 92.55% NA
Indica Intermediate  786 1.50% 17.00% 0.64% 80.79% NA
Temperate Japonica  767 85.50% 0.00% 0.26% 14.21% NA
Tropical Japonica  504 6.20% 0.40% 1.19% 92.26% NA
Japonica Intermediate  241 26.60% 0.80% 0.41% 72.20% NA
VI/Aromatic  96 1.00% 2.10% 2.08% 94.79% NA
Intermediate  90 25.60% 5.60% 4.44% 64.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0516417324 T -> DEL LOC_Os05g28080.1 N frameshift_variant Average:48.185; most accessible tissue: Minghui63 young leaf, score: 86.891 N N N N
vg0516417324 T -> C LOC_Os05g28080.1 missense_variant ; p.Ser14Gly; MODERATE nonsynonymous_codon ; S14G Average:48.185; most accessible tissue: Minghui63 young leaf, score: 86.891 unknown unknown TOLERATED 0.41

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0516417324 T C -0.02 -0.01 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0516417324 NA 9.74E-08 mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516417324 NA 9.15E-06 mr1639 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516417324 NA 9.67E-14 mr1087_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516417324 NA 1.23E-07 mr1090_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516417324 NA 1.02E-08 mr1091_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516417324 NA 3.05E-06 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516417324 NA 4.32E-06 mr1112_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516417324 NA 6.46E-06 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516417324 NA 4.90E-10 mr1235_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516417324 NA 3.00E-06 mr1423_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516417324 NA 7.66E-08 mr1582_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516417324 NA 1.48E-08 mr1599_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516417324 NA 8.92E-06 mr1695_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516417324 NA 5.35E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516417324 NA 1.71E-11 mr1844_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516417324 NA 9.21E-06 mr1844_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516417324 NA 1.37E-08 mr1862_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251