\
| Variant ID: vg0516249459 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 16249459 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CTTAATAGTCTATTTTCTAGGTTTTAAGTTGCGAATAATATGGATATAAAAATTTTTACTATCGTATTTCCTTGCTGCAAGTATATAAGCATGTATTTAT[C/T]
GGACATCAGTAATGTTATTTTTATAAAAATATTAAAATTTGATTATGAGCATCCGTAGATGGTTAATAGATCTAATATAATATATATACGTAAGTTTTAT
ATAAAACTTACGTATATATATTATATTAGATCTATTAACCATCTACGGATGCTCATAATCAAATTTTAATATTTTTATAAAAATAACATTACTGATGTCC[G/A]
ATAAATACATGCTTATATACTTGCAGCAAGGAAATACGATAGTAAAAATTTTTATATCCATATTATTCGCAACTTAAAACCTAGAAAATAGACTATTAAG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.50% | 25.30% | 0.17% | 0.00% | NA |
| All Indica | 2759 | 99.10% | 0.80% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 24.90% | 74.90% | 0.20% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.70% | 1.00% | 0.34% | 0.00% | NA |
| Indica II | 465 | 98.70% | 1.10% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 7.00% | 92.80% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 53.60% | 46.20% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 21.60% | 78.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 91.70% | 8.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 62.20% | 35.60% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0516249459 | C -> T | LOC_Os05g27860.1 | downstream_gene_variant ; 3580.0bp to feature; MODIFIER | silent_mutation | Average:30.61; most accessible tissue: Callus, score: 69.295 | N | N | N | N |
| vg0516249459 | C -> T | LOC_Os05g27870.1 | downstream_gene_variant ; 3567.0bp to feature; MODIFIER | silent_mutation | Average:30.61; most accessible tissue: Callus, score: 69.295 | N | N | N | N |
| vg0516249459 | C -> T | LOC_Os05g27860-LOC_Os05g27870 | intergenic_region ; MODIFIER | silent_mutation | Average:30.61; most accessible tissue: Callus, score: 69.295 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0516249459 | NA | 1.54E-42 | Grain_thickness | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0516249459 | 8.66E-08 | 7.22E-66 | Grain_width | All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0516249459 | NA | 1.02E-14 | Grain_width | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0516249459 | NA | 1.53E-35 | mr1310 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516249459 | NA | 2.61E-06 | mr1422 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516249459 | NA | 9.20E-08 | mr1423 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516249459 | NA | 2.10E-36 | mr1533 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516249459 | NA | 1.47E-17 | mr1699 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516249459 | NA | 2.53E-45 | mr1771 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516249459 | NA | 3.04E-14 | mr1771 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516249459 | NA | 1.04E-39 | mr1784 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516249459 | NA | 1.76E-11 | mr1784 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516249459 | NA | 4.41E-07 | mr1785 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516249459 | NA | 4.90E-10 | mr1790 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516249459 | NA | 1.14E-07 | mr1800 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516249459 | NA | 3.30E-24 | mr1862 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516249459 | NA | 1.31E-33 | mr1980 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516249459 | NA | 2.58E-31 | mr1310_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516249459 | NA | 4.70E-39 | mr1533_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516249459 | NA | 7.00E-17 | mr1699_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516249459 | NA | 9.06E-41 | mr1771_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516249459 | NA | 1.06E-09 | mr1771_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516249459 | NA | 1.79E-44 | mr1784_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516249459 | NA | 1.11E-14 | mr1790_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516249459 | NA | 1.42E-13 | mr1800_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |