Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0516249459:

Variant ID: vg0516249459 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 16249459
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTTAATAGTCTATTTTCTAGGTTTTAAGTTGCGAATAATATGGATATAAAAATTTTTACTATCGTATTTCCTTGCTGCAAGTATATAAGCATGTATTTAT[C/T]
GGACATCAGTAATGTTATTTTTATAAAAATATTAAAATTTGATTATGAGCATCCGTAGATGGTTAATAGATCTAATATAATATATATACGTAAGTTTTAT

Reverse complement sequence

ATAAAACTTACGTATATATATTATATTAGATCTATTAACCATCTACGGATGCTCATAATCAAATTTTAATATTTTTATAAAAATAACATTACTGATGTCC[G/A]
ATAAATACATGCTTATATACTTGCAGCAAGGAAATACGATAGTAAAAATTTTTATATCCATATTATTCGCAACTTAAAACCTAGAAAATAGACTATTAAG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.50%	25.30%	0.17%	0.00%	NA
All Indica	2759	99.10%	0.80%	0.11%	0.00%	NA
All Japonica	1512	24.90%	74.90%	0.20%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.70%	1.00%	0.34%	0.00%	NA
Indica II	465	98.70%	1.10%	0.22%	0.00%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	98.70%	1.30%	0.00%	0.00%	NA
Temperate Japonica	767	7.00%	92.80%	0.13%	0.00%	NA
Tropical Japonica	504	53.60%	46.20%	0.20%	0.00%	NA
Japonica Intermediate	241	21.60%	78.00%	0.41%	0.00%	NA
VI/Aromatic	96	91.70%	8.30%	0.00%	0.00%	NA
Intermediate	90	62.20%	35.60%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0516249459	C -> T	LOC_Os05g27860.1	downstream_gene_variant ; 3580.0bp to feature; MODIFIER	silent_mutation	Average:30.61; most accessible tissue: Callus, score: 69.295	N	N	N	N
vg0516249459	C -> T	LOC_Os05g27870.1	downstream_gene_variant ; 3567.0bp to feature; MODIFIER	silent_mutation	Average:30.61; most accessible tissue: Callus, score: 69.295	N	N	N	N
vg0516249459	C -> T	LOC_Os05g27860-LOC_Os05g27870	intergenic_region ; MODIFIER	silent_mutation	Average:30.61; most accessible tissue: Callus, score: 69.295	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0516249459	NA	1.54E-42	Grain_thickness	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0516249459	8.66E-08	7.22E-66	Grain_width	All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0516249459	NA	1.02E-14	Grain_width	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0516249459	NA	1.53E-35	mr1310	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516249459	NA	2.61E-06	mr1422	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516249459	NA	9.20E-08	mr1423	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516249459	NA	2.10E-36	mr1533	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516249459	NA	1.47E-17	mr1699	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516249459	NA	2.53E-45	mr1771	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516249459	NA	3.04E-14	mr1771	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516249459	NA	1.04E-39	mr1784	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516249459	NA	1.76E-11	mr1784	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516249459	NA	4.41E-07	mr1785	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516249459	NA	4.90E-10	mr1790	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516249459	NA	1.14E-07	mr1800	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516249459	NA	3.30E-24	mr1862	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516249459	NA	1.31E-33	mr1980	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516249459	NA	2.58E-31	mr1310_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516249459	NA	4.70E-39	mr1533_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516249459	NA	7.00E-17	mr1699_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516249459	NA	9.06E-41	mr1771_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516249459	NA	1.06E-09	mr1771_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516249459	NA	1.79E-44	mr1784_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516249459	NA	1.11E-14	mr1790_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516249459	NA	1.42E-13	mr1800_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251