\
| Variant ID: vg0516242828 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 16242828 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 109. )
GCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAATATATCCTGAAGGGGCAGACACCGAACTTCAACACATTACCAAAGCTAAGGGATCACT[G/A]
GGATGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGG
CCCCAAGTGGTGATGGTACTTCTTCTTGGCGGCATTTTCTTTGTTTCTTTCCATCATCGCCTGCCCTTGTTCACCTGTCTTATATGCAACGAACTCATCC[C/T]
AGTGATCCCTTAGCTTTGGTAATGTGTTGAAGTTCGGTGTCTGCCCCTTCAGGATATATTTCTGGTACAGATCTCCCTTGAAGCTCTGAAACTGTTCTGC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.80% | 40.00% | 0.19% | 0.00% | NA |
| All Indica | 2759 | 84.80% | 14.90% | 0.25% | 0.00% | NA |
| All Japonica | 1512 | 24.10% | 75.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 31.60% | 68.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.00% | 4.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 71.80% | 28.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 83.50% | 16.40% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 85.80% | 13.50% | 0.76% | 0.00% | NA |
| Temperate Japonica | 767 | 7.00% | 93.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 52.40% | 47.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 19.50% | 80.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 0.00% | 99.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 41.10% | 57.80% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0516242828 | G -> A | LOC_Os05g27860.1 | stop_gained ; p.Trp57*; HIGH | stop_gained | Average:21.772; most accessible tissue: Zhenshan97 flag leaf, score: 33.231 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0516242828 | NA | 1.40E-14 | Grain_width | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0516242828 | NA | 1.27E-11 | mr1540 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516242828 | NA | 3.04E-13 | mr1732 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516242828 | NA | 4.07E-08 | mr1800 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516242828 | NA | 2.87E-06 | mr1423_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516242828 | NA | 7.63E-08 | mr1446_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516242828 | NA | 4.52E-19 | mr1539_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516242828 | NA | 1.11E-21 | mr1540_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516242828 | NA | 2.88E-06 | mr1540_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516242828 | NA | 5.92E-22 | mr1732_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516242828 | 4.57E-06 | 1.34E-07 | mr1732_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516242828 | NA | 9.84E-10 | mr1771_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516242828 | NA | 9.55E-10 | mr1784_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |