\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0516240465:

Variant ID: vg0516240465 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 16240465
Reference Allele: AAlternative Allele: C,T
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGACGAGCCTAAGCGTCACATGATTCTCCCAGGCAAAAGAAAAATCGTCGGAGTTGAGGACAAGACTGACGAGGATTACGATCAGTTGGATGGGCAACCC[A/C,T]
CTTTCACGGTAACGATTGACCCTAGCATCCTCCTATCAAATGAAGACACCCCTTACTCACGTAGCGATCACAAGGAGGGAACAATAGTGAGGAGAAAGTA

Reverse complement sequence

TACTTTCTCCTCACTATTGTTCCCTCCTTGTGATCGCTACGTGAGTAAGGGGTGTCTTCATTTGATAGGAGGATGCTAGGGTCAATCGTTACCGTGAAAG[T/G,A]
GGGTTGCCCATCCAACTGATCGTAATCCTCGTCAGTCTTGTCCTCAACTCCGACGATTTTTCTTTTGCCTGGGAGAATCATGTGACGCTTAGGCTCGTCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.60% 27.50% 0.74% 0.00% T: 0.11%
All Indica  2759 63.50% 35.30% 1.16% 0.00% T: 0.04%
All Japonica  1512 99.50% 0.50% 0.00% 0.00% T: 0.07%
Aus  269 20.40% 79.20% 0.00% 0.00% T: 0.37%
Indica I  595 77.80% 20.30% 1.85% 0.00% NA
Indica II  465 53.50% 45.60% 0.86% 0.00% NA
Indica III  913 65.50% 34.20% 0.33% 0.00% NA
Indica Intermediate  786 56.10% 42.00% 1.78% 0.00% T: 0.13%
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.80% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.20% 0.00% 0.00% T: 0.41%
VI/Aromatic  96 10.40% 86.50% 1.04% 0.00% T: 2.08%
Intermediate  90 72.20% 25.60% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0516240465 A -> T LOC_Os05g27850.1 missense_variant ; p.Thr940Ser; MODERATE nonsynonymous_codon ; T940S Average:20.53; most accessible tissue: Minghui63 young leaf, score: 29.964 unknown unknown DELETERIOUS 0.01
vg0516240465 A -> C LOC_Os05g27850.1 missense_variant ; p.Thr940Pro; MODERATE frameshift_variant Average:20.53; most accessible tissue: Minghui63 young leaf, score: 29.964 N N N N
vg0516240465 A -> C LOC_Os05g27850.1 missense_variant ; p.Thr940Pro; MODERATE nonsynonymous_codon ; T940P Average:20.53; most accessible tissue: Minghui63 young leaf, score: 29.964 unknown unknown TOLERATED 1.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0516240465 NA 1.01E-38 Grain_thickness All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0516240465 NA 2.02E-57 Grain_width All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0516240465 NA 7.99E-15 Grain_width Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0516240465 NA 4.26E-10 mr1235 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516240465 NA 6.51E-07 mr1422 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516240465 NA 6.64E-09 mr1423 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516240465 NA 1.05E-10 mr1471 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516240465 NA 2.58E-06 mr1555 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516240465 NA 4.44E-45 mr1563 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516240465 NA 9.78E-16 mr1699 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516240465 2.39E-06 3.13E-48 mr1771 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516240465 NA 5.21E-15 mr1771 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516240465 NA 1.59E-42 mr1784 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516240465 NA 9.55E-12 mr1784 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516240465 NA 2.04E-07 mr1785 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516240465 NA 5.62E-25 mr1805 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516240465 NA 9.07E-14 mr1844 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516240465 NA 8.67E-26 mr1862 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516240465 NA 4.41E-39 mr1771_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516240465 NA 2.18E-13 mr1800_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516240465 NA 7.10E-08 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251