Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0516240465:

Variant ID: vg0516240465 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 16240465
Reference Allele: A	Alternative Allele: C,T
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGACGAGCCTAAGCGTCACATGATTCTCCCAGGCAAAAGAAAAATCGTCGGAGTTGAGGACAAGACTGACGAGGATTACGATCAGTTGGATGGGCAACCC[A/C,T]
CTTTCACGGTAACGATTGACCCTAGCATCCTCCTATCAAATGAAGACACCCCTTACTCACGTAGCGATCACAAGGAGGGAACAATAGTGAGGAGAAAGTA

Reverse complement sequence

TACTTTCTCCTCACTATTGTTCCCTCCTTGTGATCGCTACGTGAGTAAGGGGTGTCTTCATTTGATAGGAGGATGCTAGGGTCAATCGTTACCGTGAAAG[T/G,A]
GGGTTGCCCATCCAACTGATCGTAATCCTCGTCAGTCTTGTCCTCAACTCCGACGATTTTTCTTTTGCCTGGGAGAATCATGTGACGCTTAGGCTCGTCA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.60%	27.50%	0.74%	0.00%	T: 0.11%
All Indica	2759	63.50%	35.30%	1.16%	0.00%	T: 0.04%
All Japonica	1512	99.50%	0.50%	0.00%	0.00%	T: 0.07%
Aus	269	20.40%	79.20%	0.00%	0.00%	T: 0.37%
Indica I	595	77.80%	20.30%	1.85%	0.00%	NA
Indica II	465	53.50%	45.60%	0.86%	0.00%	NA
Indica III	913	65.50%	34.20%	0.33%	0.00%	NA
Indica Intermediate	786	56.10%	42.00%	1.78%	0.00%	T: 0.13%
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.20%	0.80%	0.00%	0.00%	NA
Japonica Intermediate	241	98.30%	1.20%	0.00%	0.00%	T: 0.41%
VI/Aromatic	96	10.40%	86.50%	1.04%	0.00%	T: 2.08%
Intermediate	90	72.20%	25.60%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0516240465	A -> T	LOC_Os05g27850.1	missense_variant ; p.Thr940Ser; MODERATE	nonsynonymous_codon ; T940S	Average:20.53; most accessible tissue: Minghui63 young leaf, score: 29.964	unknown	unknown	DELETERIOUS	0.01
vg0516240465	A -> C	LOC_Os05g27850.1	missense_variant ; p.Thr940Pro; MODERATE	frameshift_variant	Average:20.53; most accessible tissue: Minghui63 young leaf, score: 29.964	N	N	N	N
vg0516240465	A -> C	LOC_Os05g27850.1	missense_variant ; p.Thr940Pro; MODERATE	nonsynonymous_codon ; T940P	Average:20.53; most accessible tissue: Minghui63 young leaf, score: 29.964	unknown	unknown	TOLERATED	1.00

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0516240465	NA	1.01E-38	Grain_thickness	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0516240465	NA	2.02E-57	Grain_width	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0516240465	NA	7.99E-15	Grain_width	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0516240465	NA	4.26E-10	mr1235	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516240465	NA	6.51E-07	mr1422	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516240465	NA	6.64E-09	mr1423	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516240465	NA	1.05E-10	mr1471	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516240465	NA	2.58E-06	mr1555	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516240465	NA	4.44E-45	mr1563	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516240465	NA	9.78E-16	mr1699	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516240465	2.39E-06	3.13E-48	mr1771	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516240465	NA	5.21E-15	mr1771	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516240465	NA	1.59E-42	mr1784	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516240465	NA	9.55E-12	mr1784	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516240465	NA	2.04E-07	mr1785	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516240465	NA	5.62E-25	mr1805	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516240465	NA	9.07E-14	mr1844	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516240465	NA	8.67E-26	mr1862	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516240465	NA	4.41E-39	mr1771_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516240465	NA	2.18E-13	mr1800_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516240465	NA	7.10E-08	mr1805_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251