\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0516132563:

Variant ID: vg0516132563 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 16132563
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACAAGAAATATTTGCTAAGTCTATAGGTCATACTTGCTAAGCGTAATATTAAAACTCTACTAATCTTGTATTAAAACTCTAACAATCATATATGCTAAGT[C/T]
TAAGTGTCGTATATTAGAACCCTAGATAATCATATATGCTAAGTCTAATTAAGTTTTGTATATTAAAACTCTAATAATCTTATATTAAAATTGTAGTAAT

Reverse complement sequence

ATTACTACAATTTTAATATAAGATTATTAGAGTTTTAATATACAAAACTTAATTAGACTTAGCATATATGATTATCTAGGGTTCTAATATACGACACTTA[G/A]
ACTTAGCATATATGATTGTTAGAGTTTTAATACAAGATTAGTAGAGTTTTAATATTACGCTTAGCAAGTATGACCTATAGACTTAGCAAATATTTCTTGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.10% 0.80% 11.74% 35.34% NA
All Indica  2759 39.90% 1.30% 17.98% 40.74% NA
All Japonica  1512 75.80% 0.00% 0.33% 23.88% NA
Aus  269 23.80% 0.40% 17.10% 58.74% NA
Indica I  595 40.00% 3.40% 12.44% 44.20% NA
Indica II  465 33.30% 1.10% 15.91% 49.68% NA
Indica III  913 38.90% 0.00% 24.21% 36.91% NA
Indica Intermediate  786 45.00% 1.50% 16.16% 37.28% NA
Temperate Japonica  767 93.00% 0.00% 0.00% 7.04% NA
Tropical Japonica  504 47.00% 0.00% 0.99% 51.98% NA
Japonica Intermediate  241 81.30% 0.00% 0.00% 18.67% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 61.10% 0.00% 8.89% 30.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0516132563 C -> T LOC_Os05g27680.1 upstream_gene_variant ; 4355.0bp to feature; MODIFIER silent_mutation Average:34.665; most accessible tissue: Zhenshan97 flag leaf, score: 49.845 N N N N
vg0516132563 C -> T LOC_Os05g27690.1 upstream_gene_variant ; 109.0bp to feature; MODIFIER silent_mutation Average:34.665; most accessible tissue: Zhenshan97 flag leaf, score: 49.845 N N N N
vg0516132563 C -> T LOC_Os05g27700.1 downstream_gene_variant ; 1921.0bp to feature; MODIFIER silent_mutation Average:34.665; most accessible tissue: Zhenshan97 flag leaf, score: 49.845 N N N N
vg0516132563 C -> T LOC_Os05g27690-LOC_Os05g27700 intergenic_region ; MODIFIER silent_mutation Average:34.665; most accessible tissue: Zhenshan97 flag leaf, score: 49.845 N N N N
vg0516132563 C -> DEL N N silent_mutation Average:34.665; most accessible tissue: Zhenshan97 flag leaf, score: 49.845 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0516132563 1.15E-06 8.41E-06 mr1603 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516132563 2.85E-07 4.71E-07 mr1603 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251