\
| Variant ID: vg0516132563 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 16132563 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ACAAGAAATATTTGCTAAGTCTATAGGTCATACTTGCTAAGCGTAATATTAAAACTCTACTAATCTTGTATTAAAACTCTAACAATCATATATGCTAAGT[C/T]
TAAGTGTCGTATATTAGAACCCTAGATAATCATATATGCTAAGTCTAATTAAGTTTTGTATATTAAAACTCTAATAATCTTATATTAAAATTGTAGTAAT
ATTACTACAATTTTAATATAAGATTATTAGAGTTTTAATATACAAAACTTAATTAGACTTAGCATATATGATTATCTAGGGTTCTAATATACGACACTTA[G/A]
ACTTAGCATATATGATTGTTAGAGTTTTAATACAAGATTAGTAGAGTTTTAATATTACGCTTAGCAAGTATGACCTATAGACTTAGCAAATATTTCTTGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.10% | 0.80% | 11.74% | 35.34% | NA |
| All Indica | 2759 | 39.90% | 1.30% | 17.98% | 40.74% | NA |
| All Japonica | 1512 | 75.80% | 0.00% | 0.33% | 23.88% | NA |
| Aus | 269 | 23.80% | 0.40% | 17.10% | 58.74% | NA |
| Indica I | 595 | 40.00% | 3.40% | 12.44% | 44.20% | NA |
| Indica II | 465 | 33.30% | 1.10% | 15.91% | 49.68% | NA |
| Indica III | 913 | 38.90% | 0.00% | 24.21% | 36.91% | NA |
| Indica Intermediate | 786 | 45.00% | 1.50% | 16.16% | 37.28% | NA |
| Temperate Japonica | 767 | 93.00% | 0.00% | 0.00% | 7.04% | NA |
| Tropical Japonica | 504 | 47.00% | 0.00% | 0.99% | 51.98% | NA |
| Japonica Intermediate | 241 | 81.30% | 0.00% | 0.00% | 18.67% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 61.10% | 0.00% | 8.89% | 30.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0516132563 | C -> T | LOC_Os05g27680.1 | upstream_gene_variant ; 4355.0bp to feature; MODIFIER | silent_mutation | Average:34.665; most accessible tissue: Zhenshan97 flag leaf, score: 49.845 | N | N | N | N |
| vg0516132563 | C -> T | LOC_Os05g27690.1 | upstream_gene_variant ; 109.0bp to feature; MODIFIER | silent_mutation | Average:34.665; most accessible tissue: Zhenshan97 flag leaf, score: 49.845 | N | N | N | N |
| vg0516132563 | C -> T | LOC_Os05g27700.1 | downstream_gene_variant ; 1921.0bp to feature; MODIFIER | silent_mutation | Average:34.665; most accessible tissue: Zhenshan97 flag leaf, score: 49.845 | N | N | N | N |
| vg0516132563 | C -> T | LOC_Os05g27690-LOC_Os05g27700 | intergenic_region ; MODIFIER | silent_mutation | Average:34.665; most accessible tissue: Zhenshan97 flag leaf, score: 49.845 | N | N | N | N |
| vg0516132563 | C -> DEL | N | N | silent_mutation | Average:34.665; most accessible tissue: Zhenshan97 flag leaf, score: 49.845 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0516132563 | 1.15E-06 | 8.41E-06 | mr1603 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516132563 | 2.85E-07 | 4.71E-07 | mr1603 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |