\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0516125319:

Variant ID: vg0516125319 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 16125319
Reference Allele: CAlternative Allele: T,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTAAATTATTCCACACTGCCTTCGTTTTTTTACTCGACATTTTTTTTATAAACATAGTATAAGGGTAGACGTTCATAATATACATACACTCGCTCATAAA[C/T,A]
GCACATACATTATACCCCGATGTGTACCTCTGAGAAATGAGCCTGCATATCTTGAGAATGACGAAGTCGTAATGGACACCATTTTTTCTTCTAATTACAT

Reverse complement sequence

ATGTAATTAGAAGAAAAAATGGTGTCCATTACGACTTCGTCATTCTCAAGATATGCAGGCTCATTTCTCAGAGGTACACATCGGGGTATAATGTATGTGC[G/A,T]
TTTATGAGCGAGTGTATGTATATTATGAACGTCTACCCTTATACTATGTTTATAAAAAAAATGTCGAGTAAAAAAACGAAGGCAGTGTGGAATAATTTAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.60% 5.00% 11.34% 2.05% NA
All Indica  2759 72.60% 8.30% 15.98% 3.08% NA
All Japonica  1512 97.60% 0.10% 2.05% 0.33% NA
Aus  269 77.00% 0.00% 20.45% 2.60% NA
Indica I  595 83.20% 1.00% 14.96% 0.84% NA
Indica II  465 61.50% 12.00% 22.15% 4.30% NA
Indica III  913 72.10% 9.30% 15.01% 3.61% NA
Indica Intermediate  786 71.80% 10.60% 14.25% 3.44% NA
Temperate Japonica  767 99.30% 0.00% 0.52% 0.13% NA
Tropical Japonica  504 94.40% 0.20% 4.96% 0.40% NA
Japonica Intermediate  241 98.30% 0.00% 0.83% 0.83% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 82.20% 7.80% 10.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0516125319 C -> T LOC_Os05g27670.1 downstream_gene_variant ; 534.0bp to feature; MODIFIER silent_mutation Average:58.421; most accessible tissue: Zhenshan97 young leaf, score: 80.848 N N N N
vg0516125319 C -> T LOC_Os05g27680.1 downstream_gene_variant ; 1985.0bp to feature; MODIFIER silent_mutation Average:58.421; most accessible tissue: Zhenshan97 young leaf, score: 80.848 N N N N
vg0516125319 C -> T LOC_Os05g27690.1 downstream_gene_variant ; 3531.0bp to feature; MODIFIER silent_mutation Average:58.421; most accessible tissue: Zhenshan97 young leaf, score: 80.848 N N N N
vg0516125319 C -> T LOC_Os05g27670-LOC_Os05g27680 intergenic_region ; MODIFIER silent_mutation Average:58.421; most accessible tissue: Zhenshan97 young leaf, score: 80.848 N N N N
vg0516125319 C -> DEL N N silent_mutation Average:58.421; most accessible tissue: Zhenshan97 young leaf, score: 80.848 N N N N
vg0516125319 C -> A LOC_Os05g27670.1 downstream_gene_variant ; 534.0bp to feature; MODIFIER N Average:58.421; most accessible tissue: Zhenshan97 young leaf, score: 80.848 N N N N
vg0516125319 C -> A LOC_Os05g27680.1 downstream_gene_variant ; 1985.0bp to feature; MODIFIER N Average:58.421; most accessible tissue: Zhenshan97 young leaf, score: 80.848 N N N N
vg0516125319 C -> A LOC_Os05g27690.1 downstream_gene_variant ; 3531.0bp to feature; MODIFIER N Average:58.421; most accessible tissue: Zhenshan97 young leaf, score: 80.848 N N N N
vg0516125319 C -> A LOC_Os05g27670-LOC_Os05g27680 intergenic_region ; MODIFIER N Average:58.421; most accessible tissue: Zhenshan97 young leaf, score: 80.848 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0516125319 C A -0.01 -0.03 -0.02 -0.02 -0.01 -0.01
vg0516125319 C T -0.03 -0.02 -0.02 -0.03 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0516125319 NA 1.56E-06 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516125319 NA 3.43E-06 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516125319 NA 9.30E-06 mr1238_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516125319 NA 6.11E-06 mr1484_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516125319 NA 1.33E-10 mr1609_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516125319 NA 1.98E-06 mr1699_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251