Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0516053930:

Variant ID: vg0516053930 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 16053930
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:

AGAAATTTAATTGCATTAATTGCACGGGCCAACAGATGTAATTAGCTGTGTCCATGATTCTCTCTGCCGAAAGATTATTTCCCAACATTTAGTTATCAGA[C/T]
ACCTATCCTTTCAGTTGGTACTTTCACCATTTTCAACTTTTGGACATGATGTTTGACTGTTCATATTATTAAAAATTCAGTGTGAACATGCAAAACACAA

Reverse complement sequence

TTGTGTTTTGCATGTTCACACTGAATTTTTAATAATATGAACAGTCAAACATCATGTCCAAAAGTTGAAAATGGTGAAAGTACCAACTGAAAGGATAGGT[G/A]
TCTGATAACTAAATGTTGGGAAATAATCTTTCGGCAGAGAGAATCATGGACACAGCTAATTACATCTGTTGGCCCGTGCAATTAATGCAATTAAATTTCT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.40%	10.70%	2.92%	1.97%	NA
All Indica	2759	79.40%	17.60%	2.65%	0.40%	NA
All Japonica	1512	89.50%	1.10%	4.03%	5.42%	NA
Aus	269	98.50%	0.70%	0.74%	0.00%	NA
Indica I	595	88.60%	7.20%	3.70%	0.50%	NA
Indica II	465	67.70%	29.00%	2.58%	0.65%	NA
Indica III	913	75.90%	21.50%	2.19%	0.44%	NA
Indica Intermediate	786	83.30%	14.10%	2.42%	0.13%	NA
Temperate Japonica	767	96.30%	0.50%	1.30%	1.83%	NA
Tropical Japonica	504	78.40%	2.40%	8.53%	10.71%	NA
Japonica Intermediate	241	90.90%	0.00%	3.32%	5.81%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	94.40%	3.30%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0516053930	C -> T	LOC_Os05g27580.1	upstream_gene_variant ; 3139.0bp to feature; MODIFIER	silent_mutation	Average:52.328; most accessible tissue: Zhenshan97 flag leaf, score: 67.785	N	N	N	N
vg0516053930	C -> T	LOC_Os05g27590.1	downstream_gene_variant ; 4383.0bp to feature; MODIFIER	silent_mutation	Average:52.328; most accessible tissue: Zhenshan97 flag leaf, score: 67.785	N	N	N	N
vg0516053930	C -> T	LOC_Os05g27580-LOC_Os05g27590	intergenic_region ; MODIFIER	silent_mutation	Average:52.328; most accessible tissue: Zhenshan97 flag leaf, score: 67.785	N	N	N	N
vg0516053930	C -> DEL	N	N	silent_mutation	Average:52.328; most accessible tissue: Zhenshan97 flag leaf, score: 67.785	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0516053930	NA	2.26E-08	mr1039	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516053930	NA	5.73E-08	mr1632	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516053930	NA	1.83E-07	mr1039_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516053930	9.11E-06	NA	mr1632_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516053930	NA	1.29E-09	mr1632_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251