\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0515954806:

Variant ID: vg0515954806 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 15954806
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATTATTGTAGTACTACTATCGACGAGATCGTCGATAGGCGCATATGGAGCTACCTGGGAGTATACACGGCATGCTGGAACCCCTGTCATCGGAACAGGC[A/G]
TGGTGTGCGGTTGCCGGTTGGCTGCAGATGTTTTGGCCCGGCCGACTGCTTTGATTGCCAAAGTACTCCAGTCTAGCACGCTTCCCCTCGTGGCGACGTA

Reverse complement sequence

TACGTCGCCACGAGGGGAAGCGTGCTAGACTGGAGTACTTTGGCAATCAAAGCAGTCGGCCGGGCCAAAACATCTGCAGCCAACCGGCAACCGCACACCA[T/C]
GCCTGTTCCGATGACAGGGGTTCCAGCATGCCGTGTATACTCCCAGGTAGCTCCATATGCGCCTATCGACGATCTCGTCGATAGTAGTACTACAATAATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.10% 16.50% 0.00% 0.38% NA
All Indica  2759 97.70% 1.70% 0.00% 0.65% NA
All Japonica  1512 52.70% 47.30% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 96.10% 3.50% 0.00% 0.34% NA
Indica II  465 98.10% 1.50% 0.00% 0.43% NA
Indica III  913 97.90% 1.30% 0.00% 0.77% NA
Indica Intermediate  786 98.30% 0.80% 0.00% 0.89% NA
Temperate Japonica  767 17.30% 82.70% 0.00% 0.00% NA
Tropical Japonica  504 94.80% 5.20% 0.00% 0.00% NA
Japonica Intermediate  241 77.20% 22.80% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 78.90% 21.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0515954806 A -> DEL N N silent_mutation Average:85.733; most accessible tissue: Callus, score: 97.279 N N N N
vg0515954806 A -> G LOC_Os05g27440.1 upstream_gene_variant ; 4074.0bp to feature; MODIFIER silent_mutation Average:85.733; most accessible tissue: Callus, score: 97.279 N N N N
vg0515954806 A -> G LOC_Os05g27440-LOC_Os05g27450 intergenic_region ; MODIFIER silent_mutation Average:85.733; most accessible tissue: Callus, score: 97.279 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0515954806 A G 0.05 0.01 -0.02 -0.03 -0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0515954806 NA 1.88E-38 Grain_thickness All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0515954806 NA 6.36E-10 mr1368 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515954806 9.50E-06 NA mr1023_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515954806 NA 1.06E-09 mr1087_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515954806 NA 5.35E-06 mr1091_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515954806 NA 1.07E-32 mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515954806 NA 8.15E-08 mr1350_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515954806 NA 1.23E-16 mr1730_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515954806 2.79E-06 NA mr1778_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515954806 NA 6.47E-12 mr1853_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515954806 NA 3.13E-15 mr1866_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515954806 NA 1.28E-13 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515954806 NA 1.63E-19 mr1980_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251