Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0515954806:

Variant ID: vg0515954806 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 15954806
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TATTATTGTAGTACTACTATCGACGAGATCGTCGATAGGCGCATATGGAGCTACCTGGGAGTATACACGGCATGCTGGAACCCCTGTCATCGGAACAGGC[A/G]
TGGTGTGCGGTTGCCGGTTGGCTGCAGATGTTTTGGCCCGGCCGACTGCTTTGATTGCCAAAGTACTCCAGTCTAGCACGCTTCCCCTCGTGGCGACGTA

Reverse complement sequence

TACGTCGCCACGAGGGGAAGCGTGCTAGACTGGAGTACTTTGGCAATCAAAGCAGTCGGCCGGGCCAAAACATCTGCAGCCAACCGGCAACCGCACACCA[T/C]
GCCTGTTCCGATGACAGGGGTTCCAGCATGCCGTGTATACTCCCAGGTAGCTCCATATGCGCCTATCGACGATCTCGTCGATAGTAGTACTACAATAATA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.10%	16.50%	0.00%	0.38%	NA
All Indica	2759	97.70%	1.70%	0.00%	0.65%	NA
All Japonica	1512	52.70%	47.30%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	96.10%	3.50%	0.00%	0.34%	NA
Indica II	465	98.10%	1.50%	0.00%	0.43%	NA
Indica III	913	97.90%	1.30%	0.00%	0.77%	NA
Indica Intermediate	786	98.30%	0.80%	0.00%	0.89%	NA
Temperate Japonica	767	17.30%	82.70%	0.00%	0.00%	NA
Tropical Japonica	504	94.80%	5.20%	0.00%	0.00%	NA
Japonica Intermediate	241	77.20%	22.80%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	78.90%	21.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0515954806	A -> DEL	N	N	silent_mutation	Average:85.733; most accessible tissue: Callus, score: 97.279	N	N	N	N
vg0515954806	A -> G	LOC_Os05g27440.1	upstream_gene_variant ; 4074.0bp to feature; MODIFIER	silent_mutation	Average:85.733; most accessible tissue: Callus, score: 97.279	N	N	N	N
vg0515954806	A -> G	LOC_Os05g27440-LOC_Os05g27450	intergenic_region ; MODIFIER	silent_mutation	Average:85.733; most accessible tissue: Callus, score: 97.279	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0515954806	A	G	0.05	0.01	-0.02	-0.03	-0.01	-0.02

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0515954806	NA	1.88E-38	Grain_thickness	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0515954806	NA	6.36E-10	mr1368	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515954806	9.50E-06	NA	mr1023_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515954806	NA	1.06E-09	mr1087_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515954806	NA	5.35E-06	mr1091_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515954806	NA	1.07E-32	mr1310_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515954806	NA	8.15E-08	mr1350_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515954806	NA	1.23E-16	mr1730_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515954806	2.79E-06	NA	mr1778_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515954806	NA	6.47E-12	mr1853_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515954806	NA	3.13E-15	mr1866_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515954806	NA	1.28E-13	mr1959_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515954806	NA	1.63E-19	mr1980_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251