Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0515943111:

Variant ID: vg0515943111 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 15943111
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:

CCAGTTAGCTTCTGGACTTCCTTGAGTCTTGTGGGCGACTTCATGTTCTCGATTGCCTTGATCTTCTTGGGTTTGCCTCGATCCCTCTTCCAGAGACGAG[G/C]
AACCCGAGCAGCTTTCCCGATGGTACTCCGAACGTGCACTTATCTGGATTGAGCATGAGGCGATATCGTCGGAGGTTGTCGAACGTTTCCCGGAGATCGT

Reverse complement sequence

ACGATCTCCGGGAAACGTTCGACAACCTCCGACGATATCGCCTCATGCTCAATCCAGATAAGTGCACGTTCGGAGTACCATCGGGAAAGCTGCTCGGGTT[C/G]
CTCGTCTCTGGAAGAGGGATCGAGGCAAACCCAAGAAGATCAAGGCAATCGAGAACATGAAGTCGCCCACAAGACTCAAGGAAGTCCAGAAGCTAACTGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.60%	36.30%	0.04%	0.00%	NA
All Indica	2759	53.60%	46.30%	0.04%	0.00%	NA
All Japonica	1512	76.10%	23.90%	0.00%	0.00%	NA
Aus	269	80.30%	19.70%	0.00%	0.00%	NA
Indica I	595	28.60%	71.40%	0.00%	0.00%	NA
Indica II	465	69.70%	30.30%	0.00%	0.00%	NA
Indica III	913	60.80%	39.20%	0.00%	0.00%	NA
Indica Intermediate	786	54.80%	45.00%	0.13%	0.00%	NA
Temperate Japonica	767	93.20%	6.80%	0.00%	0.00%	NA
Tropical Japonica	504	48.00%	52.00%	0.00%	0.00%	NA
Japonica Intermediate	241	80.50%	19.50%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	71.10%	27.80%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0515943111	G -> C	LOC_Os05g27430.1	missense_variant ; p.Phe765Leu; MODERATE	nonsynonymous_codon ; F765L	Average:54.583; most accessible tissue: Minghui63 flag leaf, score: 79.085	benign	0.817	DELETERIOUS	0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0515943111	NA	3.28E-15	Grain_width	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0515943111	NA	8.47E-07	mr1021	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515943111	NA	8.24E-06	mr1032	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515943111	NA	2.79E-06	mr1165	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515943111	NA	3.14E-11	mr1410	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515943111	NA	2.60E-07	mr1477	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515943111	NA	9.83E-06	mr1478	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515943111	NA	1.01E-15	mr1593	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515943111	NA	1.05E-14	mr1771	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515943111	NA	1.09E-12	mr1784	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515943111	NA	9.84E-10	mr1800	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515943111	NA	1.04E-07	mr1862	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515943111	NA	3.41E-06	mr1879	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515943111	NA	8.35E-06	mr1971	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515943111	NA	1.29E-11	mr1410_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515943111	NA	7.69E-06	mr1682_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515943111	NA	7.49E-06	mr1977_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251