| Variant ID: vg0515921851 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 15921851 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 90. )
TCATGGCAAGTCGCGGTTGAACAAGGCGAAGAGGTCAACGGTTTGCCGAACCTGATACTTCCTAAGGGGGCGAACAGTAAGACTGTTCTTTTGCTATATA[C/T]
TGCTGTGCTTTGTTATTTCGCCTTATTTGACTTTTGACATAGCTTCACACTCTTCTTTTACAGTGTTGACCCTTTGACCAGGCCGAAGCCGAAGCCCGCA
TGCGGGCTTCGGCTTCGGCCTGGTCAAAGGGTCAACACTGTAAAAGAAGAGTGTGAAGCTATGTCAAAAGTCAAATAAGGCGAAATAACAAAGCACAGCA[G/A]
TATATAGCAAAAGAACAGTCTTACTGTTCGCCCCCTTAGGAAGTATCAGGTTCGGCAAACCGTTGACCTCTTCGCCTTGTTCAACCGCGACTTGCCATGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.60% | 43.80% | 1.59% | 0.02% | NA |
| All Indica | 2759 | 38.70% | 58.90% | 2.36% | 0.04% | NA |
| All Japonica | 1512 | 75.90% | 23.90% | 0.20% | 0.00% | NA |
| Aus | 269 | 81.00% | 18.20% | 0.74% | 0.00% | NA |
| Indica I | 595 | 14.10% | 81.70% | 4.20% | 0.00% | NA |
| Indica II | 465 | 58.70% | 39.40% | 1.72% | 0.22% | NA |
| Indica III | 913 | 48.70% | 49.90% | 1.31% | 0.00% | NA |
| Indica Intermediate | 786 | 33.80% | 63.60% | 2.54% | 0.00% | NA |
| Temperate Japonica | 767 | 93.20% | 6.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 47.60% | 52.20% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 79.70% | 19.50% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 58.90% | 36.70% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0515921851 | C -> T | LOC_Os05g27380.1 | upstream_gene_variant ; 1409.0bp to feature; MODIFIER | silent_mutation | Average:38.035; most accessible tissue: Minghui63 young leaf, score: 58.21 | N | N | N | N |
| vg0515921851 | C -> T | LOC_Os05g27370.1 | downstream_gene_variant ; 2874.0bp to feature; MODIFIER | silent_mutation | Average:38.035; most accessible tissue: Minghui63 young leaf, score: 58.21 | N | N | N | N |
| vg0515921851 | C -> T | LOC_Os05g27400.1 | downstream_gene_variant ; 1940.0bp to feature; MODIFIER | silent_mutation | Average:38.035; most accessible tissue: Minghui63 young leaf, score: 58.21 | N | N | N | N |
| vg0515921851 | C -> T | LOC_Os05g27390.1 | intron_variant ; MODIFIER | silent_mutation | Average:38.035; most accessible tissue: Minghui63 young leaf, score: 58.21 | N | N | N | N |
| vg0515921851 | C -> DEL | N | N | silent_mutation | Average:38.035; most accessible tissue: Minghui63 young leaf, score: 58.21 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0515921851 | NA | 3.28E-15 | Grain_width | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0515921851 | NA | 3.14E-11 | mr1410 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0515921851 | NA | 1.01E-15 | mr1593 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0515921851 | NA | 1.05E-14 | mr1771 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0515921851 | NA | 1.09E-12 | mr1784 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0515921851 | NA | 9.84E-10 | mr1800 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0515921851 | NA | 1.04E-07 | mr1862 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0515921851 | 4.65E-06 | NA | mr1904 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0515921851 | 6.49E-07 | 1.59E-09 | mr1904 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0515921851 | NA | 9.55E-07 | mr1993 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0515921851 | NA | 1.29E-11 | mr1410_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0515921851 | NA | 7.56E-09 | mr1861_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |