\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0515920069:

Variant ID: vg0515920069 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 15920069
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.83, G: 0.17, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:


ATAGAAGACACGCATTAGACCATCTAGTAGATATGTCTGTTGTCGAAACGATAACTGCATATGTCAAAAGACGTGGTTACTCAACAGTGGTTGGAAAAAT[A/G]
AAGTGTACTAAAATTTGAATTTCACTTGGGATCCCCCCATTACATGGCCCTAGGGGACTATTTATAGCCCCATTACAGGTTCTTACTACCAGGGTTTAGG

Reverse complement sequence

CCTAAACCCTGGTAGTAAGAACCTGTAATGGGGCTATAAATAGTCCCCTAGGGCCATGTAATGGGGGGATCCCAAGTGAAATTCAAATTTTAGTACACTT[T/C]
ATTTTTCCAACCACTGTTGAGTAACCACGTCTTTTGACATATGCAGTTATCGTTTCGACAACAGACATATCTACTAGATGGTCTAATGCGTGTCTTCTAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.80% 35.70% 0.51% 0.00% NA
All Indica  2759 84.70% 14.80% 0.54% 0.00% NA
All Japonica  1512 24.20% 75.60% 0.20% 0.00% NA
Aus  269 98.10% 1.90% 0.00% 0.00% NA
Indica I  595 93.80% 6.10% 0.17% 0.00% NA
Indica II  465 72.90% 26.70% 0.43% 0.00% NA
Indica III  913 79.30% 20.20% 0.55% 0.00% NA
Indica Intermediate  786 91.10% 8.00% 0.89% 0.00% NA
Temperate Japonica  767 6.80% 93.20% 0.00% 0.00% NA
Tropical Japonica  504 53.00% 46.80% 0.20% 0.00% NA
Japonica Intermediate  241 19.50% 79.70% 0.83% 0.00% NA
VI/Aromatic  96 1.00% 99.00% 0.00% 0.00% NA
Intermediate  90 51.10% 42.20% 6.67% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0515920069 A -> G LOC_Os05g27390.1 upstream_gene_variant ; 920.0bp to feature; MODIFIER silent_mutation Average:43.789; most accessible tissue: Callus, score: 68.612 N N N N
vg0515920069 A -> G LOC_Os05g27370.1 downstream_gene_variant ; 1092.0bp to feature; MODIFIER silent_mutation Average:43.789; most accessible tissue: Callus, score: 68.612 N N N N
vg0515920069 A -> G LOC_Os05g27400.1 downstream_gene_variant ; 3722.0bp to feature; MODIFIER silent_mutation Average:43.789; most accessible tissue: Callus, score: 68.612 N N N N
vg0515920069 A -> G LOC_Os05g27380.1 intron_variant ; MODIFIER silent_mutation Average:43.789; most accessible tissue: Callus, score: 68.612 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0515920069 NA 1.17E-14 Grain_width Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0515920069 NA 8.76E-10 mr1093 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515920069 NA 1.78E-18 mr1133 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515920069 NA 4.32E-12 mr1235 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515920069 NA 1.21E-07 mr1243 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515920069 NA 7.05E-10 mr1399 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515920069 NA 9.52E-12 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515920069 NA 2.30E-08 mr1423 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515920069 NA 2.88E-08 mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515920069 NA 6.73E-07 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515920069 NA 2.56E-17 mr1771 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515920069 NA 5.23E-14 mr1784 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515920069 NA 8.03E-09 mr1800 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515920069 NA 1.96E-08 mr1862 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515920069 NA 3.81E-12 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515920069 NA 5.72E-18 mr1539_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515920069 NA 9.47E-17 mr1540_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515920069 NA 2.43E-06 mr1705_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515920069 NA 4.99E-16 mr1732_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251