Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0515870259:

Variant ID: vg0515870259 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 15870259
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCATTGCTTTCGAAAATCTTTGCTTGATACATTTTAAATGTTCGAAAATTCAGAACCGTGAATGCTACTCCTTCCATCTCTCTCTTTCTAGTTTTGTCCT[G/A]
CTCCCTCCGTTCCAAAAAAAAAGACAAACCCTGGTTTCCGTAATCAACATTTGACCGTCCGTCTTATTTGAAAAAATTATGAAAAAAATTAAAAAGATAA

Reverse complement sequence

TTATCTTTTTAATTTTTTTCATAATTTTTTCAAATAAGACGGACGGTCAAATGTTGATTACGGAAACCAGGGTTTGTCTTTTTTTTTGGAACGGAGGGAG[C/T]
AGGACAAAACTAGAAAGAGAGAGATGGAAGGAGTAGCATTCACGGTTCTGAATTTTCGAACATTTAAAATGTATCAAGCAAAGATTTTCGAAAGCAATGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.10% 21.00% 15.07% 3.83% NA
All Indica  2759 69.20% 3.90% 21.02% 5.87% NA
All Japonica  1512 46.70% 46.10% 6.35% 0.86% NA
Aus  269 27.50% 61.30% 9.29% 1.86% NA
Indica I  595 48.20% 2.40% 36.13% 13.28% NA
Indica II  465 82.40% 1.90% 11.18% 4.52% NA
Indica III  913 76.20% 7.10% 14.13% 2.52% NA
Indica Intermediate  786 69.20% 2.40% 23.41% 4.96% NA
Temperate Japonica  767 16.30% 81.00% 2.09% 0.65% NA
Tropical Japonica  504 79.80% 5.00% 13.69% 1.59% NA
Japonica Intermediate  241 74.30% 21.20% 4.56% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 64.40% 22.20% 12.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0515870259 G -> DEL N N silent_mutation Average:48.734; most accessible tissue: Minghui63 young leaf, score: 90.17 N N N N
vg0515870259 G -> A LOC_Os05g27320.2 downstream_gene_variant ; 2616.0bp to feature; MODIFIER silent_mutation Average:48.734; most accessible tissue: Minghui63 young leaf, score: 90.17 N N N N
vg0515870259 G -> A LOC_Os05g27320.1 downstream_gene_variant ; 2616.0bp to feature; MODIFIER silent_mutation Average:48.734; most accessible tissue: Minghui63 young leaf, score: 90.17 N N N N
vg0515870259 G -> A LOC_Os05g27304.1 intron_variant ; MODIFIER silent_mutation Average:48.734; most accessible tissue: Minghui63 young leaf, score: 90.17 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0515870259 G A -0.02 -0.04 -0.05 0.0 -0.03 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0515870259 NA 3.22E-06 mr1077 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515870259 NA 5.79E-07 mr1206 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515870259 NA 2.38E-06 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515870259 6.70E-06 2.19E-10 mr1555 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515870259 NA 2.53E-22 mr1611 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515870259 NA 6.29E-07 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515870259 NA 4.65E-09 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515870259 NA 1.79E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515870259 NA 4.80E-08 mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251