\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0515869102:

Variant ID: vg0515869102 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 15869102
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTTTTGTTGCAAAAAAGTATTTTAATTTACTGCAACATTAGATCTATAAATAGTAAAACATTGTAAATACACTAGGTGAAATATCTTTTGTGGAAAAAA[T/G]
GAAAGAAAAGTGGGTGGGTCCAACAGTACGCACGTGGGGGGAGAGGCGCGCAGGGGGAGTGTCCGATCCGGCTCCCGCCGCACCGGGCGACCGGCGTAAA

Reverse complement sequence

TTTACGCCGGTCGCCCGGTGCGGCGGGAGCCGGATCGGACACTCCCCCTGCGCGCCTCTCCCCCCACGTGCGTACTGTTGGACCCACCCACTTTTCTTTC[A/C]
TTTTTTCCACAAAAGATATTTCACCTAGTGTATTTACAATGTTTTACTATTTATAGATCTAATGTTGCAGTAAATTAAAATACTTTTTTGCAACAAAAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.50% 21.50% 0.00% 0.00% NA
All Indica  2759 96.30% 3.70% 0.00% 0.00% NA
All Japonica  1512 52.10% 47.90% 0.00% 0.00% NA
Aus  269 37.90% 62.10% 0.00% 0.00% NA
Indica I  595 97.80% 2.20% 0.00% 0.00% NA
Indica II  465 98.50% 1.50% 0.00% 0.00% NA
Indica III  913 93.10% 6.90% 0.00% 0.00% NA
Indica Intermediate  786 97.50% 2.50% 0.00% 0.00% NA
Temperate Japonica  767 15.80% 84.20% 0.00% 0.00% NA
Tropical Japonica  504 95.00% 5.00% 0.00% 0.00% NA
Japonica Intermediate  241 77.60% 22.40% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 76.70% 23.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0515869102 T -> G LOC_Os05g27320.2 downstream_gene_variant ; 3773.0bp to feature; MODIFIER silent_mutation Average:52.426; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N
vg0515869102 T -> G LOC_Os05g27320.1 downstream_gene_variant ; 3773.0bp to feature; MODIFIER silent_mutation Average:52.426; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N
vg0515869102 T -> G LOC_Os05g27304.1 intron_variant ; MODIFIER silent_mutation Average:52.426; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0515869102 NA 8.28E-07 mr1443 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515869102 NA 3.00E-09 mr1555 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515869102 NA 4.21E-06 mr1639 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515869102 NA 8.22E-13 mr1732 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515869102 NA 3.34E-08 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515869102 NA 1.80E-11 mr1087_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515869102 NA 1.11E-06 mr1091_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515869102 NA 2.71E-06 mr1582_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515869102 NA 1.42E-15 mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251