Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0515869102:

Variant ID: vg0515869102 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 15869102
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTTTTGTTGCAAAAAAGTATTTTAATTTACTGCAACATTAGATCTATAAATAGTAAAACATTGTAAATACACTAGGTGAAATATCTTTTGTGGAAAAAA[T/G]
GAAAGAAAAGTGGGTGGGTCCAACAGTACGCACGTGGGGGGAGAGGCGCGCAGGGGGAGTGTCCGATCCGGCTCCCGCCGCACCGGGCGACCGGCGTAAA

Reverse complement sequence

TTTACGCCGGTCGCCCGGTGCGGCGGGAGCCGGATCGGACACTCCCCCTGCGCGCCTCTCCCCCCACGTGCGTACTGTTGGACCCACCCACTTTTCTTTC[A/C]
TTTTTTCCACAAAAGATATTTCACCTAGTGTATTTACAATGTTTTACTATTTATAGATCTAATGTTGCAGTAAATTAAAATACTTTTTTGCAACAAAAAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.50%	21.50%	0.00%	0.00%	NA
All Indica	2759	96.30%	3.70%	0.00%	0.00%	NA
All Japonica	1512	52.10%	47.90%	0.00%	0.00%	NA
Aus	269	37.90%	62.10%	0.00%	0.00%	NA
Indica I	595	97.80%	2.20%	0.00%	0.00%	NA
Indica II	465	98.50%	1.50%	0.00%	0.00%	NA
Indica III	913	93.10%	6.90%	0.00%	0.00%	NA
Indica Intermediate	786	97.50%	2.50%	0.00%	0.00%	NA
Temperate Japonica	767	15.80%	84.20%	0.00%	0.00%	NA
Tropical Japonica	504	95.00%	5.00%	0.00%	0.00%	NA
Japonica Intermediate	241	77.60%	22.40%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	76.70%	23.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0515869102	T -> G	LOC_Os05g27320.2	downstream_gene_variant ; 3773.0bp to feature; MODIFIER	silent_mutation	Average:52.426; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N
vg0515869102	T -> G	LOC_Os05g27320.1	downstream_gene_variant ; 3773.0bp to feature; MODIFIER	silent_mutation	Average:52.426; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N
vg0515869102	T -> G	LOC_Os05g27304.1	intron_variant ; MODIFIER	silent_mutation	Average:52.426; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0515869102	NA	8.28E-07	mr1443	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515869102	NA	3.00E-09	mr1555	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515869102	NA	4.21E-06	mr1639	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515869102	NA	8.22E-13	mr1732	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515869102	NA	3.34E-08	mr1763	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515869102	NA	1.80E-11	mr1087_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515869102	NA	1.11E-06	mr1091_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515869102	NA	2.71E-06	mr1582_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515869102	NA	1.42E-15	mr1807_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251