\
| Variant ID: vg0515869102 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 15869102 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTTTTTGTTGCAAAAAAGTATTTTAATTTACTGCAACATTAGATCTATAAATAGTAAAACATTGTAAATACACTAGGTGAAATATCTTTTGTGGAAAAAA[T/G]
GAAAGAAAAGTGGGTGGGTCCAACAGTACGCACGTGGGGGGAGAGGCGCGCAGGGGGAGTGTCCGATCCGGCTCCCGCCGCACCGGGCGACCGGCGTAAA
TTTACGCCGGTCGCCCGGTGCGGCGGGAGCCGGATCGGACACTCCCCCTGCGCGCCTCTCCCCCCACGTGCGTACTGTTGGACCCACCCACTTTTCTTTC[A/C]
TTTTTTCCACAAAAGATATTTCACCTAGTGTATTTACAATGTTTTACTATTTATAGATCTAATGTTGCAGTAAATTAAAATACTTTTTTGCAACAAAAAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.50% | 21.50% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 52.10% | 47.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 37.90% | 62.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 93.10% | 6.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 15.80% | 84.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 95.00% | 5.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 77.60% | 22.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 76.70% | 23.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0515869102 | T -> G | LOC_Os05g27320.2 | downstream_gene_variant ; 3773.0bp to feature; MODIFIER | silent_mutation | Average:52.426; most accessible tissue: Zhenshan97 panicle, score: 68.538 | N | N | N | N |
| vg0515869102 | T -> G | LOC_Os05g27320.1 | downstream_gene_variant ; 3773.0bp to feature; MODIFIER | silent_mutation | Average:52.426; most accessible tissue: Zhenshan97 panicle, score: 68.538 | N | N | N | N |
| vg0515869102 | T -> G | LOC_Os05g27304.1 | intron_variant ; MODIFIER | silent_mutation | Average:52.426; most accessible tissue: Zhenshan97 panicle, score: 68.538 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0515869102 | NA | 8.28E-07 | mr1443 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0515869102 | NA | 3.00E-09 | mr1555 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0515869102 | NA | 4.21E-06 | mr1639 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0515869102 | NA | 8.22E-13 | mr1732 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0515869102 | NA | 3.34E-08 | mr1763 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0515869102 | NA | 1.80E-11 | mr1087_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0515869102 | NA | 1.11E-06 | mr1091_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0515869102 | NA | 2.71E-06 | mr1582_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0515869102 | NA | 1.42E-15 | mr1807_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |