| Variant ID: vg0515848995 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 15848995 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 113. )
CTATAGATCCTGCAACAGCTTTCCGGAAAATACTGCAATCTGAACAACTATCGGAAACTGACTTTGATGCTGCCGAGAGTTTCTGCTCTTTGATCATAAA[C/A]
ACTTCGCTTCCATATCTTCGGTAAAGATGATTTGTTGAAAAGAGATTCTATGCCATATACCTTGTTGACTAAACATTTCTATTTCTGGACCAAACTCTCG
CGAGAGTTTGGTCCAGAAATAGAAATGTTTAGTCAACAAGGTATATGGCATAGAATCTCTTTTCAACAAATCATCTTTACCGAAGATATGGAAGCGAAGT[G/T]
TTTATGATCAAAGAGCAGAAACTCTCGGCAGCATCAAAGTCAGTTTCCGATAGTTGTTCAGATTGCAGTATTTTCCGGAAAGCTGTTGCAGGATCTATAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 35.30% | 21.50% | 17.29% | 25.92% | NA |
| All Indica | 2759 | 14.40% | 34.60% | 20.44% | 30.59% | NA |
| All Japonica | 1512 | 75.20% | 1.90% | 2.98% | 19.91% | NA |
| Aus | 269 | 1.90% | 5.60% | 69.89% | 22.68% | NA |
| Indica I | 595 | 6.90% | 22.00% | 13.28% | 57.82% | NA |
| Indica II | 465 | 28.80% | 30.10% | 21.29% | 19.78% | NA |
| Indica III | 913 | 16.80% | 46.40% | 20.48% | 16.32% | NA |
| Indica Intermediate | 786 | 8.70% | 33.10% | 25.32% | 32.95% | NA |
| Temperate Japonica | 767 | 91.80% | 1.40% | 0.26% | 6.52% | NA |
| Tropical Japonica | 504 | 49.20% | 0.40% | 7.54% | 42.86% | NA |
| Japonica Intermediate | 241 | 76.80% | 6.60% | 2.07% | 14.52% | NA |
| VI/Aromatic | 96 | 89.60% | 6.20% | 4.17% | 0.00% | NA |
| Intermediate | 90 | 47.80% | 13.30% | 17.78% | 21.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0515848995 | C -> DEL | N | N | silent_mutation | Average:42.849; most accessible tissue: Minghui63 young leaf, score: 70.038 | N | N | N | N |
| vg0515848995 | C -> A | LOC_Os05g27270.1 | upstream_gene_variant ; 3345.0bp to feature; MODIFIER | silent_mutation | Average:42.849; most accessible tissue: Minghui63 young leaf, score: 70.038 | N | N | N | N |
| vg0515848995 | C -> A | LOC_Os05g27250.1 | downstream_gene_variant ; 1127.0bp to feature; MODIFIER | silent_mutation | Average:42.849; most accessible tissue: Minghui63 young leaf, score: 70.038 | N | N | N | N |
| vg0515848995 | C -> A | LOC_Os05g27260.1 | downstream_gene_variant ; 772.0bp to feature; MODIFIER | silent_mutation | Average:42.849; most accessible tissue: Minghui63 young leaf, score: 70.038 | N | N | N | N |
| vg0515848995 | C -> A | LOC_Os05g27250-LOC_Os05g27260 | intergenic_region ; MODIFIER | silent_mutation | Average:42.849; most accessible tissue: Minghui63 young leaf, score: 70.038 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0515848995 | NA | 3.41E-08 | mr1547 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0515848995 | NA | 3.53E-07 | mr1547 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0515848995 | 7.50E-13 | 3.46E-22 | mr1709 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0515848995 | 1.45E-10 | 3.39E-19 | mr1709 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0515848995 | NA | 4.47E-06 | mr1291_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0515848995 | NA | 4.22E-06 | mr1291_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0515848995 | NA | 6.11E-07 | mr1547_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0515848995 | NA | 3.65E-06 | mr1547_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0515848995 | 1.94E-07 | 7.18E-29 | mr1709_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0515848995 | NA | 1.76E-20 | mr1709_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |