\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0515848995:

Variant ID: vg0515848995 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 15848995
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


CTATAGATCCTGCAACAGCTTTCCGGAAAATACTGCAATCTGAACAACTATCGGAAACTGACTTTGATGCTGCCGAGAGTTTCTGCTCTTTGATCATAAA[C/A]
ACTTCGCTTCCATATCTTCGGTAAAGATGATTTGTTGAAAAGAGATTCTATGCCATATACCTTGTTGACTAAACATTTCTATTTCTGGACCAAACTCTCG

Reverse complement sequence

CGAGAGTTTGGTCCAGAAATAGAAATGTTTAGTCAACAAGGTATATGGCATAGAATCTCTTTTCAACAAATCATCTTTACCGAAGATATGGAAGCGAAGT[G/T]
TTTATGATCAAAGAGCAGAAACTCTCGGCAGCATCAAAGTCAGTTTCCGATAGTTGTTCAGATTGCAGTATTTTCCGGAAAGCTGTTGCAGGATCTATAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 35.30% 21.50% 17.29% 25.92% NA
All Indica  2759 14.40% 34.60% 20.44% 30.59% NA
All Japonica  1512 75.20% 1.90% 2.98% 19.91% NA
Aus  269 1.90% 5.60% 69.89% 22.68% NA
Indica I  595 6.90% 22.00% 13.28% 57.82% NA
Indica II  465 28.80% 30.10% 21.29% 19.78% NA
Indica III  913 16.80% 46.40% 20.48% 16.32% NA
Indica Intermediate  786 8.70% 33.10% 25.32% 32.95% NA
Temperate Japonica  767 91.80% 1.40% 0.26% 6.52% NA
Tropical Japonica  504 49.20% 0.40% 7.54% 42.86% NA
Japonica Intermediate  241 76.80% 6.60% 2.07% 14.52% NA
VI/Aromatic  96 89.60% 6.20% 4.17% 0.00% NA
Intermediate  90 47.80% 13.30% 17.78% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0515848995 C -> DEL N N silent_mutation Average:42.849; most accessible tissue: Minghui63 young leaf, score: 70.038 N N N N
vg0515848995 C -> A LOC_Os05g27270.1 upstream_gene_variant ; 3345.0bp to feature; MODIFIER silent_mutation Average:42.849; most accessible tissue: Minghui63 young leaf, score: 70.038 N N N N
vg0515848995 C -> A LOC_Os05g27250.1 downstream_gene_variant ; 1127.0bp to feature; MODIFIER silent_mutation Average:42.849; most accessible tissue: Minghui63 young leaf, score: 70.038 N N N N
vg0515848995 C -> A LOC_Os05g27260.1 downstream_gene_variant ; 772.0bp to feature; MODIFIER silent_mutation Average:42.849; most accessible tissue: Minghui63 young leaf, score: 70.038 N N N N
vg0515848995 C -> A LOC_Os05g27250-LOC_Os05g27260 intergenic_region ; MODIFIER silent_mutation Average:42.849; most accessible tissue: Minghui63 young leaf, score: 70.038 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0515848995 NA 3.41E-08 mr1547 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515848995 NA 3.53E-07 mr1547 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515848995 7.50E-13 3.46E-22 mr1709 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515848995 1.45E-10 3.39E-19 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515848995 NA 4.47E-06 mr1291_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515848995 NA 4.22E-06 mr1291_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515848995 NA 6.11E-07 mr1547_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515848995 NA 3.65E-06 mr1547_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515848995 1.94E-07 7.18E-29 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515848995 NA 1.76E-20 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251