\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0515848994:

Variant ID: vg0515848994 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 15848994
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.75, A: 0.24, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


ACTATAGATCCTGCAACAGCTTTCCGGAAAATACTGCAATCTGAACAACTATCGGAAACTGACTTTGATGCTGCCGAGAGTTTCTGCTCTTTGATCATAA[A/C]
CACTTCGCTTCCATATCTTCGGTAAAGATGATTTGTTGAAAAGAGATTCTATGCCATATACCTTGTTGACTAAACATTTCTATTTCTGGACCAAACTCTC

Reverse complement sequence

GAGAGTTTGGTCCAGAAATAGAAATGTTTAGTCAACAAGGTATATGGCATAGAATCTCTTTTCAACAAATCATCTTTACCGAAGATATGGAAGCGAAGTG[T/G]
TTATGATCAAAGAGCAGAAACTCTCGGCAGCATCAAAGTCAGTTTCCGATAGTTGTTCAGATTGCAGTATTTTCCGGAAAGCTGTTGCAGGATCTATAGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.70% 15.30% 10.35% 21.67% NA
All Indica  2759 56.20% 9.50% 10.55% 23.74% NA
All Japonica  1512 51.90% 26.30% 2.31% 19.44% NA
Aus  269 28.60% 0.00% 49.44% 21.93% NA
Indica I  595 46.60% 2.20% 8.24% 43.03% NA
Indica II  465 51.00% 22.20% 9.03% 17.85% NA
Indica III  913 65.10% 11.70% 9.64% 13.58% NA
Indica Intermediate  786 56.20% 5.10% 14.25% 24.43% NA
Temperate Japonica  767 86.40% 8.30% 0.00% 5.22% NA
Tropical Japonica  504 9.50% 40.50% 5.56% 44.44% NA
Japonica Intermediate  241 30.70% 53.90% 2.90% 12.45% NA
VI/Aromatic  96 33.30% 50.00% 16.67% 0.00% NA
Intermediate  90 50.00% 16.70% 15.56% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0515848994 A -> DEL N N silent_mutation Average:42.849; most accessible tissue: Minghui63 young leaf, score: 70.038 N N N N
vg0515848994 A -> C LOC_Os05g27270.1 upstream_gene_variant ; 3346.0bp to feature; MODIFIER silent_mutation Average:42.849; most accessible tissue: Minghui63 young leaf, score: 70.038 N N N N
vg0515848994 A -> C LOC_Os05g27250.1 downstream_gene_variant ; 1126.0bp to feature; MODIFIER silent_mutation Average:42.849; most accessible tissue: Minghui63 young leaf, score: 70.038 N N N N
vg0515848994 A -> C LOC_Os05g27260.1 downstream_gene_variant ; 773.0bp to feature; MODIFIER silent_mutation Average:42.849; most accessible tissue: Minghui63 young leaf, score: 70.038 N N N N
vg0515848994 A -> C LOC_Os05g27250-LOC_Os05g27260 intergenic_region ; MODIFIER silent_mutation Average:42.849; most accessible tissue: Minghui63 young leaf, score: 70.038 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0515848994 NA 5.58E-06 mr1271 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515848994 NA 1.16E-08 mr1547 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515848994 NA 8.16E-06 mr1639 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515848994 2.71E-10 1.29E-14 mr1709 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515848994 8.09E-11 8.88E-20 mr1709 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515848994 NA 3.05E-11 mr1087_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515848994 NA 3.42E-06 mr1091_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515848994 NA 2.01E-07 mr1350_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515848994 NA 9.84E-10 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515848994 NA 9.15E-09 mr1547_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515848994 NA 5.21E-07 mr1582_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515848994 NA 1.75E-17 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515848994 NA 5.99E-21 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515848994 NA 7.75E-08 mr1808_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515848994 NA 3.32E-06 mr1892_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251