Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0515732737:

Variant ID: vg0515732737 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 15732737
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCTTTCAATTGGTATCAGAGCCCGGTTAAGTTCGTTGTAACCTAACCGTGGCAACGAACGCAGCTATGGAGGAAAAATACTCTATGAAACCATTTGTTTT[C/T]
GATGGACACAATTTTGTCATTTGGAAGGCACGAATGGAGGCCTACCTCCCGTCGCAAGGGCATAATGTGTGGAATAAGGTTAAATCACCTTACACTGTGC

Reverse complement sequence

GCACAGTGTAAGGTGATTTAACCTTATTCCACACATTATGCCCTTGCGACGGGAGGTAGGCCTCCATTCGTGCCTTCCAAATGACAAAATTGTGTCCATC[G/A]
AAAACAAATGGTTTCATAGAGTATTTTTCCTCCATAGCTGCGTTCGTTGCCACGGTTAGGTTACAACGAACTTAACCGGGCTCTGATACCAATTGAAAGA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.50%	16.60%	4.25%	12.67%	NA
All Indica	2759	96.70%	1.40%	0.69%	1.16%	NA
All Japonica	1512	5.40%	47.80%	10.25%	36.57%	NA
Aus	269	92.20%	0.70%	7.06%	0.00%	NA
Indica I	595	94.60%	3.40%	1.34%	0.67%	NA
Indica II	465	95.10%	1.70%	0.65%	2.58%	NA
Indica III	913	98.60%	0.50%	0.44%	0.44%	NA
Indica Intermediate	786	97.20%	0.80%	0.51%	1.53%	NA
Temperate Japonica	767	2.70%	82.80%	1.96%	12.52%	NA
Tropical Japonica	504	7.10%	6.50%	18.25%	68.06%	NA
Japonica Intermediate	241	10.00%	22.80%	19.92%	47.30%	NA
VI/Aromatic	96	82.30%	2.10%	6.25%	9.38%	NA
Intermediate	90	71.10%	21.10%	2.22%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0515732737	C -> T	LOC_Os05g27060.1	synonymous_variant ; p.Phe12Phe; LOW	synonymous_codon	Average:8.375; most accessible tissue: Callus, score: 15.811	N	N	N	N
vg0515732737	C -> DEL	LOC_Os05g27060.1	N	frameshift_variant	Average:8.375; most accessible tissue: Callus, score: 15.811	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0515732737	NA	1.18E-14	Grain_thickness	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0515732737	NA	3.57E-10	mr1235	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515732737	NA	5.70E-08	mr1243	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515732737	NA	8.10E-07	mr1415	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515732737	NA	1.03E-07	mr1423	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515732737	NA	8.75E-06	mr1555	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515732737	NA	8.10E-07	mr1567	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515732737	NA	4.43E-10	mr1087_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515732737	NA	6.13E-11	mr1089_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515732737	NA	4.96E-06	mr1091_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515732737	NA	1.62E-10	mr1093_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515732737	NA	7.01E-12	mr1235_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515732737	NA	5.64E-07	mr1243_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515732737	NA	6.51E-09	mr1251_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515732737	NA	1.82E-06	mr1257_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515732737	NA	3.58E-08	mr1423_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515732737	NA	6.95E-09	mr1435_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515732737	NA	3.30E-10	mr1599_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515732737	NA	5.31E-08	mr1805_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515732737	NA	1.64E-08	mr1862_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515732737	NA	2.51E-07	mr1991_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251