\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0515669145:

Variant ID: vg0515669145 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 15669145
Reference Allele: CAlternative Allele: G
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, G: 0.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


TGTGGACACGATACTCTTAGTAGGATGAGAACATGCAACTTGCTTGCCGGCTTGACAAGCACTACAAAGCTTATCTTTCTCAAACTTCACATCTTTCAAG[C/G]
CCACAACTAGATCACGTTTTGAAAGTTTGCTCAATTAATTCATGCCAACATGAGCTAGCCTCCTATGCCAAAGCCAACCCAATGAAGTTTTTGCAACTAA

Reverse complement sequence

TTAGTTGCAAAAACTTCATTGGGTTGGCTTTGGCATAGGAGGCTAGCTCATGTTGGCATGAATTAATTGAGCAAACTTTCAAAACGTGATCTAGTTGTGG[G/C]
CTTGAAAGATGTGAAGTTTGAGAAAGATAAGCTTTGTAGTGCTTGTCAAGCCGGCAAGCAAGTTGCATGTTCTCATCCTACTAAGAGTATCGTGTCCACA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.70% 40.40% 0.42% 0.53% NA
All Indica  2759 81.90% 17.60% 0.54% 0.00% NA
All Japonica  1512 21.10% 77.20% 0.07% 1.65% NA
Aus  269 55.80% 44.20% 0.00% 0.00% NA
Indica I  595 93.60% 6.20% 0.17% 0.00% NA
Indica II  465 72.70% 26.70% 0.65% 0.00% NA
Indica III  913 71.90% 27.70% 0.44% 0.00% NA
Indica Intermediate  786 90.10% 9.00% 0.89% 0.00% NA
Temperate Japonica  767 4.60% 93.90% 0.00% 1.56% NA
Tropical Japonica  504 49.20% 50.20% 0.20% 0.40% NA
Japonica Intermediate  241 14.90% 80.50% 0.00% 4.56% NA
VI/Aromatic  96 1.00% 99.00% 0.00% 0.00% NA
Intermediate  90 47.80% 47.80% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0515669145 C -> DEL N N silent_mutation Average:14.496; most accessible tissue: Callus, score: 20.483 N N N N
vg0515669145 C -> G LOC_Os05g26970.1 intron_variant ; MODIFIER silent_mutation Average:14.496; most accessible tissue: Callus, score: 20.483 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0515669145 4.92E-06 4.92E-06 mr1208 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515669145 NA 5.89E-16 mr1301 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515669145 NA 5.69E-15 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515669145 NA 9.65E-06 mr1596 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515669145 NA 9.72E-19 mr1699 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515669145 NA 6.13E-13 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515669145 NA 3.60E-13 mr1771 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515669145 NA 9.65E-08 mr1800 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515669145 NA 8.59E-08 mr1862 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515669145 NA 3.90E-07 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515669145 NA 6.91E-06 mr1039_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515669145 6.42E-07 1.36E-22 mr1301_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515669145 5.02E-06 2.79E-17 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515669145 NA 3.15E-07 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515669145 NA 3.14E-07 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515669145 NA 5.04E-08 mr1606_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515669145 NA 9.07E-08 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515669145 NA 2.32E-06 mr1705_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515669145 NA 3.51E-06 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515669145 NA 7.14E-10 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515669145 NA 1.37E-14 mr1993_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251