\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0515519848:

Variant ID: vg0515519848 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 15519848
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.72, G: 0.28, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


GTTTCACAATATAAGTCATTCTAGCATTTTCCACATTCATATTGATGTTAATGAATTTAGATAGATATATATGTCTAGATTCATTAACATCAATATGAAT[A/G]
TAGGAAATGCTAGAATGACTTACATTGTGAAACGGAGGGAGTAGCATGGAACTTAACTAAGAGTGCTCAAGTTCAGGCCGCATCAAGTACTGCTACCAAT

Reverse complement sequence

ATTGGTAGCAGTACTTGATGCGGCCTGAACTTGAGCACTCTTAGTTAAGTTCCATGCTACTCCCTCCGTTTCACAATGTAAGTCATTCTAGCATTTCCTA[T/C]
ATTCATATTGATGTTAATGAATCTAGACATATATATCTATCTAAATTCATTAACATCAATATGAATGTGGAAAATGCTAGAATGACTTATATTGTGAAAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.40% 37.60% 0.40% 0.57% NA
All Indica  2759 82.30% 16.90% 0.43% 0.36% NA
All Japonica  1512 21.20% 77.30% 0.46% 1.06% NA
Aus  269 98.50% 1.50% 0.00% 0.00% NA
Indica I  595 91.60% 6.60% 1.01% 0.84% NA
Indica II  465 71.60% 28.20% 0.22% 0.00% NA
Indica III  913 75.00% 24.50% 0.11% 0.33% NA
Indica Intermediate  786 90.20% 9.00% 0.51% 0.25% NA
Temperate Japonica  767 5.70% 93.90% 0.00% 0.39% NA
Tropical Japonica  504 45.60% 50.80% 1.39% 2.18% NA
Japonica Intermediate  241 19.10% 80.10% 0.00% 0.83% NA
VI/Aromatic  96 3.10% 96.90% 0.00% 0.00% NA
Intermediate  90 48.90% 50.00% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0515519848 A -> DEL N N silent_mutation Average:55.177; most accessible tissue: Zhenshan97 flag leaf, score: 72.757 N N N N
vg0515519848 A -> G LOC_Os05g26730.1 downstream_gene_variant ; 3238.0bp to feature; MODIFIER silent_mutation Average:55.177; most accessible tissue: Zhenshan97 flag leaf, score: 72.757 N N N N
vg0515519848 A -> G LOC_Os05g26750.1 downstream_gene_variant ; 4405.0bp to feature; MODIFIER silent_mutation Average:55.177; most accessible tissue: Zhenshan97 flag leaf, score: 72.757 N N N N
vg0515519848 A -> G LOC_Os05g26740.1 intron_variant ; MODIFIER silent_mutation Average:55.177; most accessible tissue: Zhenshan97 flag leaf, score: 72.757 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0515519848 NA 4.31E-10 mr1093 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515519848 NA 1.14E-07 mr1206 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515519848 NA 1.22E-07 mr1229 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515519848 NA 6.61E-12 mr1235 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515519848 NA 2.58E-10 mr1243 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515519848 NA 3.62E-07 mr1403 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515519848 NA 2.06E-12 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515519848 NA 5.78E-09 mr1423 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515519848 NA 3.58E-06 mr1596 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515519848 NA 1.51E-07 mr1599 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515519848 NA 4.55E-18 mr1699 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515519848 NA 4.89E-14 mr1771 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515519848 NA 2.37E-13 mr1784 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515519848 NA 1.41E-08 mr1800 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515519848 NA 5.67E-10 mr1862 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515519848 NA 1.91E-06 mr1039_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515519848 NA 2.17E-18 mr1301_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515519848 NA 1.13E-13 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515519848 NA 1.75E-12 mr1993_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251