\
| Variant ID: vg0515318112 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 15318112 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 99. )
CTTTAACCGAGTTTGATCTTCGGTATGAGTCGCCGAAGGCGATTAAGGGACAAGCTATAGCCGATTTTATTGTGGAACATCGTGATGATTCAATCGGCTC[G/A]
GTTGAAATAGTGCCATGGACTTTATTCTTTGATGGATCGGTGTGCACTCATGGTTGTGGTATTGACCTAGTTATAATTTCCCCTAGGGGGGCATGTTTCG
CGAAACATGCCCCCCTAGGGGAAATTATAACTAGGTCAATACCACAACCATGAGTGCACACCGATCCATCAAAGAATAAAGTCCATGGCACTATTTCAAC[C/T]
GAGCCGATTGAATCATCACGATGTTCCACAATAAAATCGGCTATAGCTTGTCCCTTAATCGCCTTCGGCGACTCATACCGAAGATCAAACTCGGTTAAAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.90% | 39.00% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 47.90% | 52.00% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 78.10% | 21.80% | 0.07% | 0.00% | NA |
| Aus | 269 | 81.00% | 19.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 31.90% | 67.90% | 0.17% | 0.00% | NA |
| Indica II | 465 | 62.60% | 37.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 55.40% | 44.40% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 42.50% | 57.40% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 52.00% | 47.80% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 80.90% | 19.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 68.90% | 30.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0515318112 | G -> A | LOC_Os05g26330.1 | synonymous_variant ; p.Ser358Ser; LOW | synonymous_codon | Average:35.111; most accessible tissue: Zhenshan97 flag leaf, score: 58.772 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0515318112 | NA | 8.28E-07 | mr1243 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0515318112 | NA | 2.49E-13 | mr1771 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0515318112 | NA | 5.98E-12 | mr1784 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0515318112 | NA | 1.25E-10 | mr1800 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0515318112 | 9.92E-06 | 1.05E-10 | mr1862 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0515318112 | NA | 9.71E-07 | mr1217_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0515318112 | NA | 7.31E-12 | mr1410_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0515318112 | NA | 1.36E-07 | mr1676_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |