\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0515288716:

Variant ID: vg0515288716 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 15288716
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTGACGAGTTCTTGCTTTCGGGTTGAGCTGCATCGGTTTCGATGTTCAACAAGAGGTAAAACTTGTTATGACGTTTTGTGTTCTCGGGATTAGTGCTTC[T/C]
ATCTTTATGATACTCTAATCTTGTTTATGTAATTCGTCGAGTTATCATATATTTTACATAATCTCTGGCAATATCGCTATCTAACCTACGATCGGCTAAC

Reverse complement sequence

GTTAGCCGATCGTAGGTTAGATAGCGATATTGCCAGAGATTATGTAAAATATATGATAACTCGACGAATTACATAAACAAGATTAGAGTATCATAAAGAT[A/G]
GAAGCACTAATCCCGAGAACACAAAACGTCATAACAAGTTTTACCTCTTGTTGAACATCGAAACCGATGCAGCTCAACCCGAAAGCAAGAACTCGTCAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.10% 6.30% 3.91% 19.61% NA
All Indica  2759 80.40% 5.30% 0.65% 13.66% NA
All Japonica  1512 55.70% 4.40% 10.65% 29.30% NA
Aus  269 70.30% 29.00% 0.37% 0.37% NA
Indica I  595 94.80% 1.50% 1.18% 2.52% NA
Indica II  465 76.10% 0.60% 1.08% 22.15% NA
Indica III  913 65.80% 10.80% 0.11% 23.22% NA
Indica Intermediate  786 89.10% 4.30% 0.64% 5.98% NA
Temperate Japonica  767 61.10% 7.80% 18.90% 12.13% NA
Tropical Japonica  504 55.80% 0.80% 0.60% 42.86% NA
Japonica Intermediate  241 38.20% 0.80% 5.39% 55.60% NA
VI/Aromatic  96 9.40% 0.00% 1.04% 89.58% NA
Intermediate  90 62.20% 11.10% 4.44% 22.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0515288716 T -> DEL N N silent_mutation Average:18.746; most accessible tissue: Zhenshan97 root, score: 25.639 N N N N
vg0515288716 T -> C LOC_Os05g26270.1 upstream_gene_variant ; 4363.0bp to feature; MODIFIER silent_mutation Average:18.746; most accessible tissue: Zhenshan97 root, score: 25.639 N N N N
vg0515288716 T -> C LOC_Os05g26280.1 upstream_gene_variant ; 848.0bp to feature; MODIFIER silent_mutation Average:18.746; most accessible tissue: Zhenshan97 root, score: 25.639 N N N N
vg0515288716 T -> C LOC_Os05g26290.1 upstream_gene_variant ; 976.0bp to feature; MODIFIER silent_mutation Average:18.746; most accessible tissue: Zhenshan97 root, score: 25.639 N N N N
vg0515288716 T -> C LOC_Os05g26280-LOC_Os05g26290 intergenic_region ; MODIFIER silent_mutation Average:18.746; most accessible tissue: Zhenshan97 root, score: 25.639 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0515288716 7.36E-08 4.15E-10 mr1588_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515288716 NA 7.22E-06 mr1768_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251