\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0515173997:

Variant ID: vg0515173997 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 15173997
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.76, G: 0.22, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


CATTAATTTTTCGACTTTAAATAATTTTAATGCACTATTTTCTATTTTAGAAACACATATGTAATGGAAATTAATATTCAGTGCACTTATTAGTAGTCCC[A/G]
GTTCTTAACCCTAACCGGGTTTAAAAAGAATTTGGAAATAGCGGGAAAATATCTTTAGTCCCGGTTGATGAGAACAACCGGGAGTAAAGATAGCTTTACT

Reverse complement sequence

AGTAAAGCTATCTTTACTCCCGGTTGTTCTCATCAACCGGGACTAAAGATATTTTCCCGCTATTTCCAAATTCTTTTTAAACCCGGTTAGGGTTAAGAAC[T/C]
GGGACTACTAATAAGTGCACTGAATATTAATTTCCATTACATATGTGTTTCTAAAATAGAAAATAGTGCATTAAAATTATTTAAAGTCGAAAAATTAATG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.40% 36.90% 1.57% 0.11% NA
All Indica  2759 81.60% 16.50% 1.96% 0.00% NA
All Japonica  1512 22.70% 75.90% 1.12% 0.33% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 88.60% 6.40% 5.04% 0.00% NA
Indica II  465 72.70% 27.10% 0.22% 0.00% NA
Indica III  913 75.20% 24.50% 0.22% 0.00% NA
Indica Intermediate  786 88.80% 8.50% 2.67% 0.00% NA
Temperate Japonica  767 6.10% 91.30% 1.96% 0.65% NA
Tropical Japonica  504 49.20% 50.40% 0.40% 0.00% NA
Japonica Intermediate  241 19.90% 80.10% 0.00% 0.00% NA
VI/Aromatic  96 1.00% 99.00% 0.00% 0.00% NA
Intermediate  90 46.70% 50.00% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0515173997 A -> DEL N N silent_mutation Average:21.613; most accessible tissue: Zhenshan97 root, score: 38.035 N N N N
vg0515173997 A -> G LOC_Os05g26100.1 upstream_gene_variant ; 2347.0bp to feature; MODIFIER silent_mutation Average:21.613; most accessible tissue: Zhenshan97 root, score: 38.035 N N N N
vg0515173997 A -> G LOC_Os05g26080.1 downstream_gene_variant ; 3401.0bp to feature; MODIFIER silent_mutation Average:21.613; most accessible tissue: Zhenshan97 root, score: 38.035 N N N N
vg0515173997 A -> G LOC_Os05g26090.1 downstream_gene_variant ; 961.0bp to feature; MODIFIER silent_mutation Average:21.613; most accessible tissue: Zhenshan97 root, score: 38.035 N N N N
vg0515173997 A -> G LOC_Os05g26090-LOC_Os05g26100 intergenic_region ; MODIFIER silent_mutation Average:21.613; most accessible tissue: Zhenshan97 root, score: 38.035 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0515173997 NA 1.77E-08 mr1206 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515173997 NA 8.43E-08 mr1229 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515173997 NA 5.39E-07 mr1243 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515173997 NA 2.32E-06 mr1338 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515173997 NA 8.02E-06 mr1596 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515173997 5.53E-06 5.75E-08 mr1623 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515173997 NA 1.84E-10 mr1862 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515173997 NA 2.68E-07 mr1039_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515173997 NA 4.16E-08 mr1217_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515173997 NA 3.24E-07 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515173997 NA 4.23E-06 mr1558_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515173997 NA 1.37E-06 mr1632_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515173997 NA 5.73E-06 mr1830_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515173997 NA 1.12E-06 mr1873_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515173997 NA 1.12E-06 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515173997 NA 4.36E-09 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251