Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0515111882:

Variant ID: vg0515111882 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 15111882
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.07, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


TGAGATTAAGCACCTATCACTATGTTGGATGTTTTATTATCCAAACTTTATGCAAATGTTGGCGGTATAGAATCGATATTTAACAGCCGCCAACAGTGCA[C/T]
CGCCCCCTCTTTCCCCAGTCAGGCTGTCTCATCTGCCAGCGGGAAGGCCGGGGGTGTTGAATCCGGCGACCCCCTCCTCTTCGCAGGCGGATCCGGCTGC

Reverse complement sequence

GCAGCCGGATCCGCCTGCGAAGAGGAGGGGGTCGCCGGATTCAACACCCCCGGCCTTCCCGCTGGCAGATGAGACAGCCTGACTGGGGAAAGAGGGGGCG[G/A]
TGCACTGTTGGCGGCTGTTAAATATCGATTCTATACCGCCAACATTTGCATAAAGTTTGGATAATAAAACATCCAACATAGTGATAGGTGCTTAATCTCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.10% 48.10% 0.08% 0.66% NA
All Indica  2759 34.80% 64.30% 0.14% 0.80% NA
All Japonica  1512 77.10% 22.60% 0.00% 0.26% NA
Aus  269 52.40% 47.60% 0.00% 0.00% NA
Indica I  595 18.50% 80.50% 0.50% 0.50% NA
Indica II  465 58.90% 40.20% 0.00% 0.86% NA
Indica III  913 40.40% 58.60% 0.00% 0.99% NA
Indica Intermediate  786 26.30% 72.80% 0.13% 0.76% NA
Temperate Japonica  767 93.70% 6.10% 0.00% 0.13% NA
Tropical Japonica  504 50.40% 49.00% 0.00% 0.60% NA
Japonica Intermediate  241 80.10% 19.90% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 0.00% 1.04% NA
Intermediate  90 60.00% 35.60% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0515111882 C -> T LOC_Os05g26010.1 upstream_gene_variant ; 4731.0bp to feature; MODIFIER silent_mutation Average:72.897; most accessible tissue: Minghui63 young leaf, score: 94.751 N N N N
vg0515111882 C -> T LOC_Os05g26000.1 downstream_gene_variant ; 4712.0bp to feature; MODIFIER silent_mutation Average:72.897; most accessible tissue: Minghui63 young leaf, score: 94.751 N N N N
vg0515111882 C -> T LOC_Os05g26000-LOC_Os05g26010 intergenic_region ; MODIFIER silent_mutation Average:72.897; most accessible tissue: Minghui63 young leaf, score: 94.751 N N N N
vg0515111882 C -> DEL N N silent_mutation Average:72.897; most accessible tissue: Minghui63 young leaf, score: 94.751 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0515111882 C T -0.01 -0.01 -0.02 -0.02 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0515111882 NA 7.99E-08 mr1206 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515111882 NA 2.30E-07 mr1229 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515111882 NA 1.34E-10 mr1235 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515111882 NA 3.06E-08 mr1243 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515111882 NA 6.03E-12 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515111882 NA 1.01E-07 mr1423 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515111882 NA 3.95E-06 mr1596 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515111882 NA 2.34E-17 mr1699 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515111882 NA 2.24E-14 mr1771 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515111882 NA 9.21E-13 mr1784 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515111882 NA 1.76E-08 mr1800 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515111882 NA 2.84E-09 mr1862 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515111882 NA 3.49E-06 mr1039_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515111882 NA 1.04E-06 mr1074_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515111882 NA 1.39E-06 mr1148_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515111882 NA 1.12E-06 mr1150_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515111882 NA 2.46E-06 mr1217_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515111882 NA 1.56E-06 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515111882 NA 6.23E-07 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515111882 NA 8.74E-06 mr1272_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515111882 NA 8.00E-16 mr1301_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515111882 NA 2.58E-13 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515111882 8.88E-06 NA mr1551_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515111882 NA 3.81E-06 mr1551_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515111882 NA 5.94E-08 mr1606_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515111882 NA 9.51E-08 mr1607_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515111882 NA 1.16E-06 mr1607_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515111882 NA 3.14E-06 mr1705_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515111882 NA 1.96E-06 mr1863_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515111882 NA 8.25E-07 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515111882 NA 1.36E-06 mr1942_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251